\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608071648:

Variant ID: vg0608071648 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 8071648
Reference Allele: TAAlternative Allele: TAA,T,AA
Primary Allele: AASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGTTTTCACACCAATAATTTCAAAGGACATTAACTAATCCAACTGTGCGTAAGTACATTTACCAGACTTTCACTCCATGGTCCTCTATTCCATTAT[TA/TAA,T,AA]
AAAAAAAAGGGAAAATCAGCCAATTTAATGCATGATTGCGAAGGGCAATCATCAATGGCTAAAACCCGTGCCACATGAGCACCATCCATCCATCCATCAT

Reverse complement sequence

ATGATGGATGGATGGATGGTGCTCATGTGGCACGGGTTTTAGCCATTGATGATTGCCCTTCGCAATCATGCATTAAATTGGCTGATTTTCCCTTTTTTTT[TA/TTA,A,TT]
ATAATGGAATAGAGGACCATGGAGTGAAAGTCTGGTAAATGTACTTACGCACAGTTGGATTAGTTAATGTCCTTTGAAATTATTGGTGTGAAAACAGAAA

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 24.10% 6.98% 20.19% TA: 5.86%; TAA: 0.47%
All Indica  2759 61.30% 1.70% 2.32% 33.67% TAA: 0.76%; TA: 0.29%
All Japonica  1512 16.50% 65.40% 0.33% 0.13% TA: 17.59%
Aus  269 1.50% 6.70% 85.50% 6.32% NA
Indica I  595 39.70% 0.00% 1.85% 58.15% TA: 0.34%
Indica II  465 90.10% 2.80% 0.00% 7.10% NA
Indica III  913 56.60% 1.60% 3.29% 35.82% TAA: 2.30%; TA: 0.33%
Indica Intermediate  786 65.90% 2.40% 2.93% 28.37% TA: 0.38%
Temperate Japonica  767 27.40% 41.20% 0.26% 0.13% TA: 31.03%
Tropical Japonica  504 1.00% 96.80% 0.20% 0.00% TA: 1.98%
Japonica Intermediate  241 14.50% 76.80% 0.83% 0.41% TA: 7.47%
VI/Aromatic  96 25.00% 46.90% 28.12% 0.00% NA
Intermediate  90 42.20% 42.20% 4.44% 6.67% TA: 3.33%; TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608071648 TA -> AA LOC_Os06g14420.1 upstream_gene_variant ; 1604.0bp to feature; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> AA LOC_Os06g14430.1 downstream_gene_variant ; 3332.0bp to feature; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> AA LOC_Os06g14420-LOC_Os06g14430 intergenic_region ; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> T LOC_Os06g14420.1 upstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> T LOC_Os06g14430.1 downstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> T LOC_Os06g14420-LOC_Os06g14430 intergenic_region ; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> DEL N N silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> TAA LOC_Os06g14420.1 upstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> TAA LOC_Os06g14430.1 downstream_gene_variant ; 3330.0bp to feature; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N
vg0608071648 TA -> TAA LOC_Os06g14420-LOC_Os06g14430 intergenic_region ; MODIFIER silent_mutation Average:96.812; most accessible tissue: Zhenshan97 flag leaf, score: 99.055 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608071648 TA AA -0.04 0.0 -0.01 -0.02 -0.02 -0.02
vg0608071648 TA T -0.36 -0.16 -0.19 -0.36 -0.31 -0.35
vg0608071648 TA TAA 0.09 0.12 -0.04 -0.03 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608071648 NA 4.26E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 3.49E-10 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 2.02E-13 mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 5.95E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 3.68E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 2.13E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 8.03E-06 7.55E-09 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 2.07E-06 6.87E-08 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 3.23E-06 NA mr1342_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 6.15E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 6.53E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 1.63E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 4.84E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 4.04E-06 3.93E-09 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 8.47E-09 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 3.56E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 3.21E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 5.63E-14 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 2.81E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 3.23E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 7.77E-07 8.60E-09 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 8.41E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 2.82E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 2.46E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 6.00E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 8.87E-06 1.68E-07 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608071648 NA 1.37E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251