Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608039241:

Variant ID: vg0608039241 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8039241
Reference Allele: A	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTCGTTCATTTTACCTTTTATGTGTGATTGTTGTATGCAGTCAACATGATTTTCTTCTTTCATTATGATTCTGGTGAATGGAAAACTATATAGTACAA[A/T,C]
TTTCTGTTCTGACCCAGCAAAGAACAGCTGTTTAGATAAAATTAAAAAATAGATAATGATGGCTGGGGGGATTGTAATCCACAAAGATATTATATTCAGC

Reverse complement sequence

GCTGAATATAATATCTTTGTGGATTACAATCCCCCCAGCCATCATTATCTATTTTTTAATTTTATCTAAACAGCTGTTCTTTGCTGGGTCAGAACAGAAA[T/A,G]
TTGTACTATATAGTTTTCCATTCACCAGAATCATAATGAAAGAAGAAAATCATGTTGACTGCATACAACAATCACACATAAAAGGTAAAATGAACGAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	34.80%	0.61%	5.10%	C: 0.02%
All Indica	2759	88.70%	1.80%	1.01%	8.52%	NA
All Japonica	1512	1.50%	98.50%	0.00%	0.07%	NA
Aus	269	92.60%	6.70%	0.37%	0.00%	C: 0.37%
Indica I	595	83.70%	0.30%	3.03%	12.94%	NA
Indica II	465	93.50%	2.80%	0.43%	3.23%	NA
Indica III	913	94.90%	1.60%	0.22%	3.29%	NA
Indica Intermediate	786	82.30%	2.50%	0.76%	14.38%	NA
Temperate Japonica	767	1.20%	98.70%	0.00%	0.13%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	47.80%	46.70%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608039241	A -> C	LOC_Os06g14390.1	upstream_gene_variant ; 3998.0bp to feature; MODIFIER	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N
vg0608039241	A -> C	LOC_Os06g14406.1	upstream_gene_variant ; 4323.0bp to feature; MODIFIER	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N
vg0608039241	A -> C	LOC_Os06g14400.1	intron_variant ; MODIFIER	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N
vg0608039241	A -> T	LOC_Os06g14390.1	upstream_gene_variant ; 3998.0bp to feature; MODIFIER	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N
vg0608039241	A -> T	LOC_Os06g14406.1	upstream_gene_variant ; 4323.0bp to feature; MODIFIER	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N
vg0608039241	A -> T	LOC_Os06g14400.1	intron_variant ; MODIFIER	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N
vg0608039241	A -> DEL	N	N	silent_mutation	Average:41.978; most accessible tissue: Callus, score: 64.932	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608039241	NA	2.97E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	1.86E-06	1.86E-06	mr1296	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	NA	3.00E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	NA	2.34E-19	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	NA	4.76E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	NA	2.44E-07	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	NA	3.12E-11	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608039241	NA	2.30E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251