Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608027015:

Variant ID: vg0608027015 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8027015
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAACCAAATCATTTGACTCGGCTCACTGAAAGAAAAAAGAAAATTAAAAAAAACATCTTGCTTCTAATTTGAAATTAATTTGTCAGACCTGTTTTTAA[C/T]
AAGCTAATACATATGCCCGCGTATCGCGCGGGCTACCTTCCTAGTTGGCAAAAAGTTACATAACTGTAGTCTCCAACTTGCGACATGTAACTTTCAGGAA

Reverse complement sequence

TTCCTGAAAGTTACATGTCGCAAGTTGGAGACTACAGTTATGTAACTTTTTGCCAACTAGGAAGGTAGCCCGCGCGATACGCGGGCATATGTATTAGCTT[G/A]
TTAAAAACAGGTCTGACAAATTAATTTCAAATTAGAAGCAAGATGTTTTTTTTAATTTTCTTTTTTCTTTCAGTGAGCCGAGTCAAATGATTTGGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	36.80%	0.28%	0.00%	NA
All Indica	2759	38.90%	60.90%	0.22%	0.00%	NA
All Japonica	1512	98.40%	1.20%	0.40%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	61.00%	39.00%	0.00%	0.00%	NA
Indica II	465	9.70%	90.10%	0.22%	0.00%	NA
Indica III	913	43.40%	56.50%	0.11%	0.00%	NA
Indica Intermediate	786	34.20%	65.30%	0.51%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.00%	0.40%	0.00%	NA
Japonica Intermediate	241	97.10%	1.20%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608027015	C -> T	LOC_Os06g14390.1	downstream_gene_variant ; 4704.0bp to feature; MODIFIER	silent_mutation	Average:56.364; most accessible tissue: Minghui63 root, score: 83.258	N	N	N	N
vg0608027015	C -> T	LOC_Os06g14379-LOC_Os06g14390	intergenic_region ; MODIFIER	silent_mutation	Average:56.364; most accessible tissue: Minghui63 root, score: 83.258	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608027015	NA	9.24E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	2.35E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	9.72E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	8.21E-06	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.62E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.53E-08	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.68E-06	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	9.14E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.88E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.49E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	3.55E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	8.67E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	8.62E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.83E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	3.69E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	9.22E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	7.13E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	2.90E-13	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.54E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	6.02E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	4.47E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	2.26E-08	4.53E-12	mr1668_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.68E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	1.09E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	2.01E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	3.01E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	4.97E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	2.83E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608027015	NA	2.42E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251