\
| Variant ID: vg0608024602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8024602 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAACTTTTTATTTATATGATTTATTATTAAAAAATAATAACTTTTTATTTATATGATTTATAAGCGCTACTACTGTTGTCATGCACGTTCAAGTTTATAC[G/A]
ATGCAAACCACTATCTTCTCCTGTACGTACTAACATACACAGAAACACAAAAACAAAACAATAGCTTACGTACTGTTCGCCGGAAAGAAAAGAAAAAACC
GGTTTTTTCTTTTCTTTCCGGCGAACAGTACGTAAGCTATTGTTTTGTTTTTGTGTTTCTGTGTATGTTAGTACGTACAGGAGAAGATAGTGGTTTGCAT[C/T]
GTATAAACTTGAACGTGCATGACAACAGTAGTAGCGCTTATAAATCATATAAATAAAAAGTTATTATTTTTTAATAATAAATCATATAAATAAAAAGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 28.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 21.60% | 78.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 35.60% | 64.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608024602 | G -> A | LOC_Os06g14379.1 | downstream_gene_variant ; 4695.0bp to feature; MODIFIER | silent_mutation | Average:38.931; most accessible tissue: Zhenshan97 flower, score: 48.393 | N | N | N | N |
| vg0608024602 | G -> A | LOC_Os06g14379-LOC_Os06g14390 | intergenic_region ; MODIFIER | silent_mutation | Average:38.931; most accessible tissue: Zhenshan97 flower, score: 48.393 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608024602 | NA | 7.18E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 3.84E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 3.43E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 3.89E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 1.96E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 5.65E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 9.99E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 5.71E-18 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 3.47E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | 2.23E-07 | NA | mr1517_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | 2.43E-06 | NA | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608024602 | NA | 5.03E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |