Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608005440:

Variant ID: vg0608005440 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8005440
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGCCACCCAACAGGATCCGATTGAACTAAGGCCCTGTTAGACACATGCATGGAGTATTAAATGTAGGAAAAAACAATTACACAGATTACGTATAAATT[A/G]
CAAGATAAATCTTTTAAATCTAATTATGCCATGATTTGACAATGTGGTGCTACAGTAAACAATTGCTAGCGACGGATTAATTAGGCTTGATAAATTCGTC

Reverse complement sequence

GACGAATTTATCAAGCCTAATTAATCCGTCGCTAGCAATTGTTTACTGTAGCACCACATTGTCAAATCATGGCATAATTAGATTTAAAAGATTTATCTTG[T/C]
AATTTATACGTAATCTGTGTAATTGTTTTTTCCTACATTTAATACTCCATGCATGTGTCTAACAGGGCCTTAGTTCAATCGGATCCTGTTGGGTGGCTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.10% 0.36% 0.00% NA
All Indica  2759 40.80% 58.80% 0.43% 0.00% NA
All Japonica  1512 98.10% 1.60% 0.26% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 62.50% 37.10% 0.34% 0.00% NA
Indica II  465 10.30% 89.50% 0.22% 0.00% NA
Indica III  913 43.40% 56.00% 0.66% 0.00% NA
Indica Intermediate  786 39.40% 60.20% 0.38% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.40% 0.40% 0.00% NA
Japonica Intermediate  241 96.30% 2.90% 0.83% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608005440 A -> G LOC_Os06g14350.1 upstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:80.807; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N
vg0608005440 A -> G LOC_Os06g14350.2 upstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:80.807; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N
vg0608005440 A -> G LOC_Os06g14350-LOC_Os06g14370 intergenic_region ; MODIFIER silent_mutation Average:80.807; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608005440 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608005440 NA 1.01E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 3.36E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 1.18E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 6.97E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 3.32E-06 6.57E-09 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 4.14E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 5.27E-06 5.58E-09 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 3.39E-06 1.70E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 6.81E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 1.95E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 2.12E-06 4.74E-07 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 4.73E-06 4.73E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 7.20E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 5.59E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 7.01E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 8.43E-06 9.77E-09 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 5.70E-06 NA mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 2.79E-08 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 2.10E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 5.37E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 1.04E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 2.16E-06 2.67E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 7.56E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 3.31E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 1.81E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 1.99E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608005440 NA 1.49E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251