\
| Variant ID: vg0608003490 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8003490 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 209. )
AATATAAAATTCTCTGAATTGAAATTTGACGTGCTCTTGGAGCCTGATGTTTTCTTAACATCCATATGAGCAGGTTTATAAAACAATAACCAGAGGCTTC[G/A]
AGTTGGCTCAAGATGATCACAAACCACTCAATATTAAGCCGGCCAAGTTAAGAAAAATTCTAACTGAATTTAAACTCGTTACATTTTATTTTGAACTTCG
CGAAGTTCAAAATAAAATGTAACGAGTTTAAATTCAGTTAGAATTTTTCTTAACTTGGCCGGCTTAATATTGAGTGGTTTGTGATCATCTTGAGCCAACT[C/T]
GAAGCCTCTGGTTATTGTTTTATAAACCTGCTCATATGGATGTTAAGAAAACATCAGGCTCCAAGAGCACGTCAAATTTCAATTCAGAGAATTTTATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.00% | 61.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 62.70% | 37.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 64.90% | 35.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608003490 | G -> A | LOC_Os06g14350.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.122; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0608003490 | G -> A | LOC_Os06g14350.2 | intron_variant ; MODIFIER | silent_mutation | Average:44.122; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608003490 | NA | 8.26E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 2.09E-06 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 8.99E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 6.27E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 9.99E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 2.38E-06 | NA | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 1.39E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 7.05E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 1.58E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 8.38E-06 | NA | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 3.80E-06 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 7.72E-06 | NA | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 1.19E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 1.90E-06 | 4.67E-06 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 6.83E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 4.99E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 5.02E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 2.55E-06 | 2.17E-09 | mr1668_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | NA | 4.96E-08 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 5.76E-07 | NA | mr1754_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608003490 | 5.18E-06 | NA | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |