\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607991758:

Variant ID: vg0607991758 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7991758
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACACATGGCTCTCAGTAATCTAATCTTCTTTTATGCAAAACTAGCTTGTTATTCTTTCCATTTCAGGTTATAAAACATTTTGACTCAAAATCAAACT[A/G]
TTTTAAGTTTGACCAAGTTTATAAAAAAAATAGTAACATTTTTAACCCAAGATAAATTTATTATGAAAGTATATTTAATTATTGATTTGATGAAACTAAT

Reverse complement sequence

ATTAGTTTCATCAAATCAATAATTAAATATACTTTCATAATAAATTTATCTTGGGTTAAAAATGTTACTATTTTTTTTATAAACTTGGTCAAACTTAAAA[T/C]
AGTTTGATTTTGAGTCAAAATGTTTTATAACCTGAAATGGAAAGAATAACAAGCTAGTTTTGCATAAAAGAAGATTAGATTACTGAGAGCCATGTGTTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 21.90% 16.10% 13.03% NA
All Indica  2759 61.30% 3.70% 20.15% 14.86% NA
All Japonica  1512 21.00% 56.80% 10.78% 11.44% NA
Aus  269 82.20% 5.60% 8.92% 3.35% NA
Indica I  595 40.20% 5.90% 37.14% 16.81% NA
Indica II  465 91.20% 2.60% 2.80% 3.44% NA
Indica III  913 57.80% 3.00% 21.03% 18.18% NA
Indica Intermediate  786 63.60% 3.60% 16.54% 16.28% NA
Temperate Japonica  767 34.90% 51.00% 7.43% 6.65% NA
Tropical Japonica  504 4.40% 62.10% 15.28% 18.25% NA
Japonica Intermediate  241 11.20% 64.30% 12.03% 12.45% NA
VI/Aromatic  96 32.30% 38.50% 12.50% 16.67% NA
Intermediate  90 58.90% 25.60% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607991758 A -> G LOC_Os06g14324.1 upstream_gene_variant ; 800.0bp to feature; MODIFIER silent_mutation Average:53.549; most accessible tissue: Callus, score: 90.1 N N N N
vg0607991758 A -> G LOC_Os06g14324.2 upstream_gene_variant ; 3809.0bp to feature; MODIFIER silent_mutation Average:53.549; most accessible tissue: Callus, score: 90.1 N N N N
vg0607991758 A -> G LOC_Os06g14340.1 downstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:53.549; most accessible tissue: Callus, score: 90.1 N N N N
vg0607991758 A -> G LOC_Os06g14324-LOC_Os06g14340 intergenic_region ; MODIFIER silent_mutation Average:53.549; most accessible tissue: Callus, score: 90.1 N N N N
vg0607991758 A -> DEL N N silent_mutation Average:53.549; most accessible tissue: Callus, score: 90.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607991758 NA 1.51E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 4.89E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 8.46E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 1.01E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 4.87E-06 4.87E-06 mr1192_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 2.75E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 6.54E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 1.09E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 1.59E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 8.92E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 5.38E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 8.64E-06 6.54E-09 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 2.79E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 1.60E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607991758 NA 5.47E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251