\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607981292:

Variant ID: vg0607981292 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7981292
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGTCAACGGTGGGATCGAGACTAGACTCAGGGAGGAATTGAGATGCAGACGGTCAAGGATACTGGATGACGAAGTTGGATACGAGATGGCACATGGTG[G/A]
ATGAATATCATGTGGGAGAGATTTTCGTAACGGGCTTCACGAGGTATGCGTGCAAGCGTCGGTTTTCGTGAAGGAGATTCGAAGAAACTGGAGAGGAGTA

Reverse complement sequence

TACTCCTCTCCAGTTTCTTCGAATCTCCTTCACGAAAACCGACGCTTGCACGCATACCTCGTGAAGCCCGTTACGAAAATCTCTCCCACATGATATTCAT[C/T]
CACCATGTGCCATCTCGTATCCAACTTCGTCATCCAGTATCCTTGACCGTCTGCATCTCAATTCCTCCCTGAGTCTAGTCTCGATCCCACCGTTGACCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 43.90% 0.49% 1.88% NA
All Indica  2759 39.50% 60.10% 0.18% 0.22% NA
All Japonica  1512 71.90% 22.30% 1.12% 4.70% NA
Aus  269 97.40% 1.90% 0.00% 0.74% NA
Indica I  595 61.00% 39.00% 0.00% 0.00% NA
Indica II  465 9.00% 90.30% 0.00% 0.65% NA
Indica III  913 42.40% 57.10% 0.44% 0.11% NA
Indica Intermediate  786 37.90% 61.70% 0.13% 0.25% NA
Temperate Japonica  767 62.50% 35.20% 0.26% 2.09% NA
Tropical Japonica  504 82.70% 6.70% 2.58% 7.94% NA
Japonica Intermediate  241 79.30% 13.70% 0.83% 6.22% NA
VI/Aromatic  96 63.50% 29.20% 0.00% 7.29% NA
Intermediate  90 41.10% 54.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607981292 G -> A LOC_Os06g14310.1 upstream_gene_variant ; 792.0bp to feature; MODIFIER silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0607981292 G -> A LOC_Os06g14290.1 downstream_gene_variant ; 3408.0bp to feature; MODIFIER silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0607981292 G -> A LOC_Os06g14300.1 downstream_gene_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0607981292 G -> A LOC_Os06g14324.1 downstream_gene_variant ; 2663.0bp to feature; MODIFIER silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0607981292 G -> A LOC_Os06g14324.2 downstream_gene_variant ; 2663.0bp to feature; MODIFIER silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0607981292 G -> A LOC_Os06g14300-LOC_Os06g14310 intergenic_region ; MODIFIER silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0607981292 G -> DEL N N silent_mutation Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607981292 NA 3.07E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 3.79E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 4.09E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 4.37E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 1.95E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 3.33E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 8.54E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 9.82E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 2.84E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 4.53E-07 1.87E-28 mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 9.89E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 8.42E-06 1.36E-17 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 1.08E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 1.79E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 3.25E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 2.54E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 1.34E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 2.25E-06 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292 NA 7.01E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251