Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607981292:

Variant ID: vg0607981292 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7981292
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGTCAACGGTGGGATCGAGACTAGACTCAGGGAGGAATTGAGATGCAGACGGTCAAGGATACTGGATGACGAAGTTGGATACGAGATGGCACATGGTG[G/A]
ATGAATATCATGTGGGAGAGATTTTCGTAACGGGCTTCACGAGGTATGCGTGCAAGCGTCGGTTTTCGTGAAGGAGATTCGAAGAAACTGGAGAGGAGTA

Reverse complement sequence

TACTCCTCTCCAGTTTCTTCGAATCTCCTTCACGAAAACCGACGCTTGCACGCATACCTCGTGAAGCCCGTTACGAAAATCTCTCCCACATGATATTCAT[C/T]
CACCATGTGCCATCTCGTATCCAACTTCGTCATCCAGTATCCTTGACCGTCTGCATCTCAATTCCTCCCTGAGTCTAGTCTCGATCCCACCGTTGACCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	43.90%	0.49%	1.88%	NA
All Indica	2759	39.50%	60.10%	0.18%	0.22%	NA
All Japonica	1512	71.90%	22.30%	1.12%	4.70%	NA
Aus	269	97.40%	1.90%	0.00%	0.74%	NA
Indica I	595	61.00%	39.00%	0.00%	0.00%	NA
Indica II	465	9.00%	90.30%	0.00%	0.65%	NA
Indica III	913	42.40%	57.10%	0.44%	0.11%	NA
Indica Intermediate	786	37.90%	61.70%	0.13%	0.25%	NA
Temperate Japonica	767	62.50%	35.20%	0.26%	2.09%	NA
Tropical Japonica	504	82.70%	6.70%	2.58%	7.94%	NA
Japonica Intermediate	241	79.30%	13.70%	0.83%	6.22%	NA
VI/Aromatic	96	63.50%	29.20%	0.00%	7.29%	NA
Intermediate	90	41.10%	54.40%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607981292	G -> A	LOC_Os06g14310.1	upstream_gene_variant ; 792.0bp to feature; MODIFIER	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0607981292	G -> A	LOC_Os06g14290.1	downstream_gene_variant ; 3408.0bp to feature; MODIFIER	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0607981292	G -> A	LOC_Os06g14300.1	downstream_gene_variant ; 157.0bp to feature; MODIFIER	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0607981292	G -> A	LOC_Os06g14324.1	downstream_gene_variant ; 2663.0bp to feature; MODIFIER	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0607981292	G -> A	LOC_Os06g14324.2	downstream_gene_variant ; 2663.0bp to feature; MODIFIER	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0607981292	G -> A	LOC_Os06g14300-LOC_Os06g14310	intergenic_region ; MODIFIER	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0607981292	G -> DEL	N	N	silent_mutation	Average:54.306; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607981292	NA	3.07E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	3.79E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	4.09E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	4.37E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	1.95E-11	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	3.33E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	8.54E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	9.82E-07	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	2.84E-09	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	4.53E-07	1.87E-28	mr1551_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	9.89E-08	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	8.42E-06	1.36E-17	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	1.08E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	1.79E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	3.25E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	2.54E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	1.34E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	2.25E-06	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607981292	NA	7.01E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251