\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607980337:

Variant ID: vg0607980337 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7980337
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGACGATAAGGACGTACTCGGAATAATTAAAAAAAAAGAGTTCAAATAAATGTTGAAAATTCTCTTGGTTATGTTTGTGATGGATCTAATTTGAGAAA[G/A]
AGTAATATTGCAATAGGTTTATATATAGGGGCTATTCTTTCAACCTATGTGCTTGTGAATATGTTGCATTATAAATCGTTTGAAATCATGAATCTTTATT

Reverse complement sequence

AATAAAGATTCATGATTTCAAACGATTTATAATGCAACATATTCACAAGCACATAGGTTGAAAGAATAGCCCCTATATATAAACCTATTGCAATATTACT[C/T]
TTTCTCAAATTAGATCCATCACAAACATAACCAAGAGAATTTTCAACATTTATTTGAACTCTTTTTTTTTAATTATTCCGAGTACGTCCTTATCGTCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 31.70% 0.66% 0.00% NA
All Indica  2759 62.40% 36.50% 1.09% 0.00% NA
All Japonica  1512 84.70% 15.30% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 39.50% 59.50% 1.01% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 60.70% 36.90% 2.41% 0.00% NA
Indica Intermediate  786 63.60% 36.10% 0.25% 0.00% NA
Temperate Japonica  767 74.40% 25.60% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607980337 G -> A LOC_Os06g14310.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:48.571; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0607980337 G -> A LOC_Os06g14290.1 downstream_gene_variant ; 2453.0bp to feature; MODIFIER silent_mutation Average:48.571; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0607980337 G -> A LOC_Os06g14324.1 downstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:48.571; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0607980337 G -> A LOC_Os06g14324.2 downstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:48.571; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0607980337 G -> A LOC_Os06g14300.1 intron_variant ; MODIFIER silent_mutation Average:48.571; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607980337 NA 4.28E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 4.20E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 1.74E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 2.22E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 9.45E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 8.63E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 9.47E-06 mr1989 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 4.81E-06 4.81E-06 mr1081_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 6.56E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 3.35E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 1.82E-06 mr1278_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 7.41E-06 mr1633_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 1.83E-06 1.14E-09 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 7.60E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980337 NA 4.99E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251