\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607980327:

Variant ID: vg0607980327 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7980327
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAACAGTCTTGACGATAAGGACGTACTCGGAATAATTAAAAAAAAAGAGTTCAAATAAATGTTGAAAATTCTCTTGGTTATGTTTGTGATGGATCTA[A/C]
TTTGAGAAAGAGTAATATTGCAATAGGTTTATATATAGGGGCTATTCTTTCAACCTATGTGCTTGTGAATATGTTGCATTATAAATCGTTTGAAATCATG

Reverse complement sequence

CATGATTTCAAACGATTTATAATGCAACATATTCACAAGCACATAGGTTGAAAGAATAGCCCCTATATATAAACCTATTGCAATATTACTCTTTCTCAAA[T/G]
TAGATCCATCACAAACATAACCAAGAGAATTTTCAACATTTATTTGAACTCTTTTTTTTTAATTATTCCGAGTACGTCCTTATCGTCAAGACTGTTTTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 21.30% 0.68% 0.00% NA
All Indica  2759 62.80% 36.00% 1.16% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 39.30% 59.50% 1.18% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 60.60% 36.90% 2.52% 0.00% NA
Indica Intermediate  786 65.40% 34.40% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607980327 A -> C LOC_Os06g14310.1 upstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:48.9; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0607980327 A -> C LOC_Os06g14290.1 downstream_gene_variant ; 2443.0bp to feature; MODIFIER silent_mutation Average:48.9; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0607980327 A -> C LOC_Os06g14324.1 downstream_gene_variant ; 3628.0bp to feature; MODIFIER silent_mutation Average:48.9; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0607980327 A -> C LOC_Os06g14324.2 downstream_gene_variant ; 3628.0bp to feature; MODIFIER silent_mutation Average:48.9; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0607980327 A -> C LOC_Os06g14300.1 intron_variant ; MODIFIER silent_mutation Average:48.9; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607980327 NA 9.33E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 3.35E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 6.11E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 4.46E-06 mr1989 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 8.41E-06 NA mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 6.80E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 4.21E-06 NA mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 2.00E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 1.48E-06 NA mr1278_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 7.03E-06 9.65E-07 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 6.17E-06 NA mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 6.77E-06 6.77E-06 mr1284_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 2.26E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 7.37E-06 NA mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 4.01E-06 4.01E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 2.92E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 7.75E-07 8.42E-07 mr1633_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 2.60E-06 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 9.88E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 5.31E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 1.88E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 2.45E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 1.28E-06 9.21E-10 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 9.65E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 9.82E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 3.53E-06 NA mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 9.05E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607980327 NA 2.07E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251