Variant ID: vg0607824902 (JBrowse) | Variation Type: INDEL |
Chromosome: chr06 | Position: 7824902 |
Reference Allele: A | Alternative Allele: T,ATTT |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, T: 0.20, others allele: 0.00, population size: 69. )
AAGACCCTTAGATTGCCTCAAGTTTCATGCAAGTGAGGAGGAATTTCTTTTGTGTGATAGGAAGCTGTGTTAGCCAGGAAGCGTGTGCATGTTTTTTTTA[A/T,ATTT]
AAAAAAATTATAGTAGATACATATAAATTACAATATATAATTACAATGTAGTTAAACTACAGTTATATCATAGTTACATTCGAAAGTTTTCAACTCAAAG
CTTTGAGTTGAAAACTTTCGAATGTAACTATGATATAACTGTAGTTTAACTACATTGTAATTATATATTGTAATTTATATGTATCTACTATAATTTTTTT[T/A,AAAT]
TAAAAAAAACATGCACACGCTTCCTGGCTAACACAGCTTCCTATCACACAAAAGAAATTCCTCCTCACTTGCATGAAACTTGAGGCAATCTAAGGGTCTT
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 59.10% | 37.30% | 3.49% | 0.11% | ATTT: 0.06% |
All Indica | 2759 | 34.50% | 60.90% | 4.46% | 0.11% | ATTT: 0.07% |
All Japonica | 1512 | 95.60% | 4.00% | 0.26% | 0.00% | ATTT: 0.07% |
Aus | 269 | 85.50% | 1.50% | 12.27% | 0.74% | NA |
Indica I | 595 | 16.80% | 80.80% | 2.35% | 0.00% | NA |
Indica II | 465 | 73.80% | 21.90% | 4.30% | 0.00% | NA |
Indica III | 913 | 22.10% | 72.40% | 5.26% | 0.11% | ATTT: 0.11% |
Indica Intermediate | 786 | 38.90% | 55.50% | 5.22% | 0.25% | ATTT: 0.13% |
Temperate Japonica | 767 | 91.90% | 7.40% | 0.52% | 0.00% | ATTT: 0.13% |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
Intermediate | 90 | 80.00% | 16.70% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0607824902 | A -> T | LOC_Os06g14040.1 | upstream_gene_variant ; 566.0bp to feature; MODIFIER | silent_mutation | Average:64.093; most accessible tissue: Zhenshan97 root, score: 78.911 | N | N | N | N |
vg0607824902 | A -> T | LOC_Os06g14030-LOC_Os06g14040 | intergenic_region ; MODIFIER | silent_mutation | Average:64.093; most accessible tissue: Zhenshan97 root, score: 78.911 | N | N | N | N |
vg0607824902 | A -> DEL | N | N | silent_mutation | Average:64.093; most accessible tissue: Zhenshan97 root, score: 78.911 | N | N | N | N |
vg0607824902 | A -> ATTT | LOC_Os06g14040.1 | upstream_gene_variant ; 565.0bp to feature; MODIFIER | silent_mutation | Average:64.093; most accessible tissue: Zhenshan97 root, score: 78.911 | N | N | N | N |
vg0607824902 | A -> ATTT | LOC_Os06g14030-LOC_Os06g14040 | intergenic_region ; MODIFIER | silent_mutation | Average:64.093; most accessible tissue: Zhenshan97 root, score: 78.911 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0607824902 | NA | 8.44E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607824902 | 3.58E-06 | 3.58E-06 | mr1371_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607824902 | NA | 2.74E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |