\
| Variant ID: vg0607815296 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7815296 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 100. )
TGAAAAAATGAATTTGTTTTTATTTTTTAAGGTAACTCCTATATAAAATGTTTTTTTTCATAAATACATCGTTTAGTAGTTTAAAAAAAATATGCTAACA[A/G]
AAAATAAGAAAGTAGGCAAACCGAACGCAGTTTAGAACGGACCATAAGATGAATAAGTTCAATATATGAGTTGGGTGAATACATTGGATAAACTCCAAAT
ATTTGGAGTTTATCCAATGTATTCACCCAACTCATATATTGAACTTATTCATCTTATGGTCCGTTCTAAACTGCGTTCGGTTTGCCTACTTTCTTATTTT[T/C]
TGTTAGCATATTTTTTTTAAACTACTAAACGATGTATTTATGAAAAAAAACATTTTATATAGGAGTTACCTTAAAAAATAAAAACAAATTCATTTTTTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.20% | 42.50% | 0.06% | 0.30% | NA |
| All Indica | 2759 | 32.10% | 67.40% | 0.07% | 0.43% | NA |
| All Japonica | 1512 | 99.10% | 0.80% | 0.00% | 0.07% | NA |
| Aus | 269 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 13.30% | 85.70% | 0.17% | 0.84% | NA |
| Indica II | 465 | 72.50% | 27.10% | 0.00% | 0.43% | NA |
| Indica III | 913 | 19.30% | 80.10% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 37.40% | 62.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 21.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607815296 | A -> G | LOC_Os06g14030-LOC_Os06g14040 | intergenic_region ; MODIFIER | silent_mutation | Average:54.295; most accessible tissue: Callus, score: 75.345 | N | N | N | N |
| vg0607815296 | A -> DEL | N | N | silent_mutation | Average:54.295; most accessible tissue: Callus, score: 75.345 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607815296 | NA | 7.59E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 6.82E-07 | mr1185_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 7.34E-08 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 8.25E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 1.81E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 3.79E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 1.18E-07 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 2.27E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 9.69E-09 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 1.24E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 2.36E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 3.19E-08 | mr1677_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 2.55E-14 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 3.79E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607815296 | NA | 4.91E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |