\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607755458:

Variant ID: vg0607755458 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7755458
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGGGTACGGGCGTGGTAGAGAGGCGGCCGGTGGCCGGAAAGCCACTGCGGGCGGCGGGCGCTGTCGCCCTCGCGCACCGCCGGGAGCAGCAGCACGGT[C/T]
GTCACCAGGGCGGCGTTAGCGGCGTCATCGTCGTCCACCTCCTTGCACCTCCACCTCCATGGTATAGATAGTTAAAAGGGAAAGGCACACAAAAGATCCT

Reverse complement sequence

AGGATCTTTTGTGTGCCTTTCCCTTTTAACTATCTATACCATGGAGGTGGAGGTGCAAGGAGGTGGACGACGATGACGCCGCTAACGCCGCCCTGGTGAC[G/A]
ACCGTGCTGCTGCTCCCGGCGGTGCGCGAGGGCGACAGCGCCCGCCGCCCGCAGTGGCTTTCCGGCCACCGGCCGCCTCTCTACCACGCCCGTACCCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 7.20% 1.63% 1.52% NA
All Indica  2759 85.00% 12.30% 2.72% 0.04% NA
All Japonica  1512 99.70% 0.00% 0.07% 0.20% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 68.90% 24.00% 7.06% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 91.60% 8.10% 0.22% 0.11% NA
Indica Intermediate  786 81.30% 15.00% 3.69% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 32.30% 0.00% 1.04% 66.67% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607755458 C -> T LOC_Os06g13920.1 downstream_gene_variant ; 2301.0bp to feature; MODIFIER silent_mutation Average:70.436; most accessible tissue: Callus, score: 80.032 N N N N
vg0607755458 C -> T LOC_Os06g13910-LOC_Os06g13920 intergenic_region ; MODIFIER silent_mutation Average:70.436; most accessible tissue: Callus, score: 80.032 N N N N
vg0607755458 C -> DEL N N silent_mutation Average:70.436; most accessible tissue: Callus, score: 80.032 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607755458 7.62E-06 NA mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 1.06E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 5.29E-06 NA mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 1.84E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 9.41E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 6.07E-06 6.07E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 5.87E-06 5.91E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 2.37E-06 2.37E-06 mr1286_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 6.09E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 2.39E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 1.48E-06 4.01E-06 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 3.57E-07 3.57E-07 mr1374_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 3.91E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 6.23E-06 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 6.65E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 8.79E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 2.26E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 7.53E-06 7.53E-06 mr1816_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 1.01E-06 1.00E-06 mr1822_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 5.37E-06 5.37E-06 mr1822_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 NA 6.68E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755458 3.08E-06 3.09E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251