\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607755407:

Variant ID: vg0607755407 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7755407
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTCTATCTCGGATGAGGAGCGGCGAGTTGGTGGCCGGCGATGGACGTGGCGGGGGTACGGGCGTGGTAGAGAGGCGGCCGGTGGCCGGAAAGCCACTG[C/T]
GGGCGGCGGGCGCTGTCGCCCTCGCGCACCGCCGGGAGCAGCAGCACGGTCGTCACCAGGGCGGCGTTAGCGGCGTCATCGTCGTCCACCTCCTTGCACC

Reverse complement sequence

GGTGCAAGGAGGTGGACGACGATGACGCCGCTAACGCCGCCCTGGTGACGACCGTGCTGCTGCTCCCGGCGGTGCGCGAGGGCGACAGCGCCCGCCGCCC[G/A]
CAGTGGCTTTCCGGCCACCGGCCGCCTCTCTACCACGCCCGTACCCCCGCCACGTCCATCGCCGGCCACCAACTCGCCGCTCCTCATCCGAGATAGAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 22.90% 2.98% 1.54% NA
All Indica  2759 56.30% 38.80% 4.93% 0.04% NA
All Japonica  1512 99.60% 0.20% 0.00% 0.20% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 26.10% 62.50% 11.43% 0.00% NA
Indica II  465 91.40% 3.90% 4.73% 0.00% NA
Indica III  913 53.10% 45.80% 0.99% 0.11% NA
Indica Intermediate  786 62.00% 33.30% 4.71% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 0.00% 1.24% NA
VI/Aromatic  96 28.10% 1.00% 3.12% 67.71% NA
Intermediate  90 88.90% 5.60% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607755407 C -> T LOC_Os06g13920.1 downstream_gene_variant ; 2352.0bp to feature; MODIFIER silent_mutation Average:64.82; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0607755407 C -> T LOC_Os06g13910-LOC_Os06g13920 intergenic_region ; MODIFIER silent_mutation Average:64.82; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0607755407 C -> DEL N N silent_mutation Average:64.82; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607755407 NA 8.83E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 4.71E-07 NA mr1184_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 2.13E-06 2.64E-08 mr1184_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 4.26E-06 NA mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 5.96E-07 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 1.07E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 9.93E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 6.66E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 6.92E-06 9.74E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 1.81E-06 1.81E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 7.97E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 1.72E-06 2.36E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 8.24E-06 6.49E-07 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 2.34E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 1.78E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 7.73E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 2.52E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 1.45E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 6.66E-06 7.93E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 4.73E-06 4.72E-06 mr1833_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607755407 NA 9.63E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251