\
| Variant ID: vg0607755407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7755407 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )
CTCTCTATCTCGGATGAGGAGCGGCGAGTTGGTGGCCGGCGATGGACGTGGCGGGGGTACGGGCGTGGTAGAGAGGCGGCCGGTGGCCGGAAAGCCACTG[C/T]
GGGCGGCGGGCGCTGTCGCCCTCGCGCACCGCCGGGAGCAGCAGCACGGTCGTCACCAGGGCGGCGTTAGCGGCGTCATCGTCGTCCACCTCCTTGCACC
GGTGCAAGGAGGTGGACGACGATGACGCCGCTAACGCCGCCCTGGTGACGACCGTGCTGCTGCTCCCGGCGGTGCGCGAGGGCGACAGCGCCCGCCGCCC[G/A]
CAGTGGCTTTCCGGCCACCGGCCGCCTCTCTACCACGCCCGTACCCCCGCCACGTCCATCGCCGGCCACCAACTCGCCGCTCCTCATCCGAGATAGAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 22.90% | 2.98% | 1.54% | NA |
| All Indica | 2759 | 56.30% | 38.80% | 4.93% | 0.04% | NA |
| All Japonica | 1512 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 26.10% | 62.50% | 11.43% | 0.00% | NA |
| Indica II | 465 | 91.40% | 3.90% | 4.73% | 0.00% | NA |
| Indica III | 913 | 53.10% | 45.80% | 0.99% | 0.11% | NA |
| Indica Intermediate | 786 | 62.00% | 33.30% | 4.71% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 28.10% | 1.00% | 3.12% | 67.71% | NA |
| Intermediate | 90 | 88.90% | 5.60% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607755407 | C -> T | LOC_Os06g13920.1 | downstream_gene_variant ; 2352.0bp to feature; MODIFIER | silent_mutation | Average:64.82; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0607755407 | C -> T | LOC_Os06g13910-LOC_Os06g13920 | intergenic_region ; MODIFIER | silent_mutation | Average:64.82; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0607755407 | C -> DEL | N | N | silent_mutation | Average:64.82; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607755407 | NA | 8.83E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 4.71E-07 | NA | mr1184_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 2.13E-06 | 2.64E-08 | mr1184_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 4.26E-06 | NA | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 5.96E-07 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 1.07E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 9.93E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 6.66E-07 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 6.92E-06 | 9.74E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 1.81E-06 | 1.81E-06 | mr1374_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 7.97E-06 | mr1417_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 1.72E-06 | 2.36E-06 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 8.24E-06 | 6.49E-07 | mr1633_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 2.34E-07 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 1.78E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 7.73E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 2.52E-07 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 1.45E-06 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 6.66E-06 | 7.93E-06 | mr1833_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | 4.73E-06 | 4.72E-06 | mr1833_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607755407 | NA | 9.63E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |