Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607723873:

Variant ID: vg0607723873 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7723873
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACAGCTAGTTAGTGTATACTCGTCCCGTGCTTTTCTCCAATAAGAGTTGGATTAAGATTAAGATTTTTGTGGCACGCTTTTCAAACTGCTAAACAGTG[T/C,G]
ATTTCGTGCGAAAACTTTCTATATGAAAGTTGCTCTAAAATATCATATTAATCTATTTTTCAAGTTTGTAATAATTAAAACTTAATCAATCATACATTAA

Reverse complement sequence

TTAATGTATGATTGATTAAGTTTTAATTATTACAAACTTGAAAAATAGATTAATATGATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGCACGAAAT[A/G,C]
CACTGTTTAGCAGTTTGAAAAGCGTGCCACAAAAATCTTAATCTTAATCCAACTCTTATTGGAGAAAAGCACGGGACGAGTATACACTAACTAGCTGTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	5.60%	6.64%	6.05%	G: 0.06%
All Indica	2759	88.40%	0.50%	2.79%	8.12%	G: 0.11%
All Japonica	1512	72.20%	15.90%	11.71%	0.26%	NA
Aus	269	85.10%	1.50%	11.90%	1.49%	NA
Indica I	595	96.80%	0.80%	2.35%	0.00%	NA
Indica II	465	90.10%	1.10%	4.73%	4.09%	NA
Indica III	913	81.20%	0.20%	1.20%	17.09%	G: 0.33%
Indica Intermediate	786	89.60%	0.40%	3.82%	6.23%	NA
Temperate Japonica	767	59.10%	22.80%	18.12%	0.00%	NA
Tropical Japonica	504	91.70%	5.60%	2.78%	0.00%	NA
Japonica Intermediate	241	73.00%	15.40%	9.96%	1.66%	NA
VI/Aromatic	96	24.00%	3.10%	21.88%	51.04%	NA
Intermediate	90	84.40%	2.20%	7.78%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607723873	T -> C	LOC_Os06g13880.1	upstream_gene_variant ; 519.0bp to feature; MODIFIER	silent_mutation	Average:24.154; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg0607723873	T -> C	LOC_Os06g13880-LOC_Os06g13890	intergenic_region ; MODIFIER	silent_mutation	Average:24.154; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg0607723873	T -> G	LOC_Os06g13880.1	upstream_gene_variant ; 519.0bp to feature; MODIFIER	silent_mutation	Average:24.154; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg0607723873	T -> G	LOC_Os06g13880-LOC_Os06g13890	intergenic_region ; MODIFIER	silent_mutation	Average:24.154; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg0607723873	T -> DEL	N	N	silent_mutation	Average:24.154; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607723873	NA	7.20E-08	mr1930	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251