\
| Variant ID: vg0607699285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7699285 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 331. )
AACTACAGTATCCCATGGATTCGCTTCAGAAGTCCCACGATTTGTGCCTGAAGCGCAAGCTTGTTGATGATTGCCTGTCGAAAGACTTCAAGTATCGCCG[C/T]
GTCGAAGAGGATAATGTATCTTCCAATGTGGAGAGCAGGCCCTTACCCGGTTCACCTTCTCAGAGTTGCTGCATTCAACCTAATCTGGCTAAAGATTGTG
CACAATCTTTAGCCAGATTAGGTTGAATGCAGCAACTCTGAGAAGGTGAACCGGGTAAGGGCCTGCTCTCCACATTGGAAGATACATTATCCTCTTCGAC[G/A]
CGGCGATACTTGAAGTCTTTCGACAGGCAATCATCAACAAGCTTGCGCTTCAGGCACAAATCGTGGGACTTCTGAAGCGAATCCATGGGATACTGTAGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 3.70% | 1.38% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 6.20% | 2.36% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.30% | 20.50% | 8.24% | 0.00% | NA |
| Indica II | 465 | 98.10% | 0.60% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 5.10% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607699285 | C -> T | LOC_Os06g13860.1 | synonymous_variant ; p.Arg29Arg; LOW | synonymous_codon | Average:74.391; most accessible tissue: Callus, score: 87.863 | N | N | N | N |
| vg0607699285 | C -> T | LOC_Os06g13860.2 | synonymous_variant ; p.Arg29Arg; LOW | synonymous_codon | Average:74.391; most accessible tissue: Callus, score: 87.863 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607699285 | NA | 5.94E-12 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 1.97E-11 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 1.87E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 9.46E-09 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 4.16E-10 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 9.58E-09 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | 4.26E-07 | 7.74E-15 | mr1201_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | 7.90E-07 | 6.37E-14 | mr1201_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 2.46E-08 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 5.26E-10 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 1.60E-13 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607699285 | NA | 1.89E-13 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |