Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607694365:

Variant ID: vg0607694365 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7694365
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.36, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGTTTCTGAAACTTCGATCACTATCATCCAGAACCAGAAGAGACATGCTAGTTAACTGATGAGAAGTCTCACTCTTTTCTTAAAAGTATTCACCAGGA[G/A]
ACAAAACTTACTAACATGACCAAGATTACCATTTGTGAATTCTTCTGGTTGCTAAAATTGACAAAACTCTTTTCTCAATCAGACTGCAAAATGGGAGACA

Reverse complement sequence

TGTCTCCCATTTTGCAGTCTGATTGAGAAAAGAGTTTTGTCAATTTTAGCAACCAGAAGAATTCACAAATGGTAATCTTGGTCATGTTAGTAAGTTTTGT[C/T]
TCCTGGTGAATACTTTTAAGAAAAGAGTGAGACTTCTCATCAGTTAACTAGCATGTCTCTTCTGGTTCTGGATGATAGTGATCGAAGTTTCAGAAACTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	13.70%	1.04%	28.29%	NA
All Indica	2759	32.80%	17.70%	1.70%	47.77%	NA
All Japonica	1512	99.00%	0.60%	0.00%	0.40%	NA
Aus	269	74.70%	24.50%	0.37%	0.37%	NA
Indica I	595	18.30%	19.80%	1.01%	60.84%	NA
Indica II	465	68.20%	6.00%	0.22%	25.59%	NA
Indica III	913	19.90%	21.50%	2.52%	56.08%	NA
Indica Intermediate	786	37.80%	18.70%	2.16%	41.35%	NA
Temperate Japonica	767	99.10%	0.50%	0.00%	0.39%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	97.50%	2.10%	0.00%	0.41%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	11.10%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607694365	G -> A	LOC_Os06g13850.1	3_prime_UTR_variant ; 2002.0bp to feature; MODIFIER	silent_mutation	Average:11.849; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg0607694365	G -> A	LOC_Os06g13860.1	upstream_gene_variant ; 4088.0bp to feature; MODIFIER	silent_mutation	Average:11.849; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg0607694365	G -> A	LOC_Os06g13860.2	upstream_gene_variant ; 4036.0bp to feature; MODIFIER	silent_mutation	Average:11.849; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg0607694365	G -> A	LOC_Os06g13839.1	downstream_gene_variant ; 475.0bp to feature; MODIFIER	silent_mutation	Average:11.849; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg0607694365	G -> DEL	N	N	silent_mutation	Average:11.849; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607694365	NA	7.74E-07	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	NA	2.39E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	NA	1.51E-06	mr1185_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	NA	4.70E-08	mr1269_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	6.83E-06	3.15E-06	mr1269_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	NA	8.26E-06	mr1399_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	NA	3.71E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607694365	NA	2.77E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251