\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607614170:

Variant ID: vg0607614170 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7614170
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAGTGAAAAGAGAGATGATGAGCCACCCCTAAATCAAGATACAATCTCCACACAAATTTCAAGAAAGATGTGAGAATATTAGATATTTTGGTATTTGT[G/A]
AACTAGAGGTGATACATTGTATAGGTTGCCTCTTGGTTCATGAGTGAATAAAATAGATAAATTTAAAGATAGTAGTCACATCTATCATAGCACTTCCCTT

Reverse complement sequence

AAGGGAAGTGCTATGATAGATGTGACTACTATCTTTAAATTTATCTATTTTATTCACTCATGAACCAAGAGGCAACCTATACAATGTATCACCTCTAGTT[C/T]
ACAAATACCAAAATATCTAATATTCTCACATCTTTCTTGAAATTTGTGTGGAGATTGTATCTTGATTTAGGGGTGGCTCATCATCTCTCTTTTCACTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.20% 0.74% 0.00% NA
All Indica  2759 88.30% 10.50% 1.23% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.70% 28.20% 4.03% 0.00% NA
Indica II  465 97.40% 2.20% 0.43% 0.00% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 90.50% 8.50% 1.02% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607614170 G -> A LOC_Os06g13740.1 upstream_gene_variant ; 2433.0bp to feature; MODIFIER silent_mutation Average:55.331; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0607614170 G -> A LOC_Os06g13730-LOC_Os06g13740 intergenic_region ; MODIFIER silent_mutation Average:55.331; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607614170 NA 1.52E-12 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 3.20E-11 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 3.26E-08 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 6.76E-09 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 8.81E-11 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 1.13E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 2.43E-07 9.04E-15 mr1201_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 1.14E-06 6.01E-13 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 2.45E-09 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 2.34E-10 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 3.46E-13 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607614170 NA 2.50E-12 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251