\
| Variant ID: vg0607535749 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7535749 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )
TATTAATTTTGCTTGTCTCGATCATTTTGGACCAGCTTCGCACAGACTAGTCAAGTTAATGCACTGAATTGACCAATTTATAAGTTTTCTTTACCTATTT[G/A]
TACCCACTATACAAGTTCAAGCATAATTTACTCTATATTTTAATACTACTAAAAGGGGTTGTAATATTTTTTTAATATAATTAAGTTCATTTTAATACTG
CAGTATTAAAATGAACTTAATTATATTAAAAAAATATTACAACCCCTTTTAGTAGTATTAAAATATAGAGTAAATTATGCTTGAACTTGTATAGTGGGTA[C/T]
AAATAGGTAAAGAAAACTTATAAATTGGTCAATTCAGTGCATTAACTTGACTAGTCTGTGCGAAGCTGGTCCAAAATGATCGAGACAAGCAAAATTAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 9.10% | 1.52% | 0.00% | NA |
| All Indica | 2759 | 82.70% | 14.60% | 2.61% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.40% | 27.20% | 8.40% | 0.00% | NA |
| Indica II | 465 | 97.20% | 1.50% | 1.29% | 0.00% | NA |
| Indica III | 913 | 86.10% | 13.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 84.20% | 13.90% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607535749 | G -> A | LOC_Os06g13600.1 | downstream_gene_variant ; 892.0bp to feature; MODIFIER | silent_mutation | Average:67.928; most accessible tissue: Zhenshan97 root, score: 85.305 | N | N | N | N |
| vg0607535749 | G -> A | LOC_Os06g13600-LOC_Os06g13610 | intergenic_region ; MODIFIER | silent_mutation | Average:67.928; most accessible tissue: Zhenshan97 root, score: 85.305 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607535749 | NA | 1.11E-09 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 1.29E-08 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 1.37E-06 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 6.51E-07 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 2.47E-09 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 3.05E-07 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | 4.26E-06 | 6.28E-11 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 2.30E-09 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 5.63E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | NA | 1.13E-07 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | 1.85E-06 | 5.82E-12 | mr1274_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | 2.05E-06 | 3.85E-11 | mr1274_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607535749 | 2.64E-06 | 7.16E-07 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |