\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607502729:

Variant ID: vg0607502729 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 7502729
Reference Allele: CCAGCAGCAGAlternative Allele: GCAGCAGCAG,CCAGCAGCAGCAG,C,CCAGCAG,CAGCAGCAGCAG
Primary Allele: CCAGCAGCAGSecondary Allele: CCAGCAGCAGCAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATATGAGACACGAAAATTATATAAATTCGGTGCGGGTCTCACACGGGCCGAACAGAACTATATATCTAAACGCAAGTACAGGACCCAAACCTGCAGCA[CCAGCAGCAG/GCAGCAGCAG,CCAGCAGCAGCAG,C,CCAGCAG,CAGCAGCAGCAG]
CAGCAGCAGCAGCTTCTCGATCGAGCTTGATTACAACTAGAAAGCAATTGCTTACCTATCAAATCACGTCTCACCCGCTAATCACACACAAACACACGCC

Reverse complement sequence

GGCGTGTGTTTGTGTGTGATTAGCGGGTGAGACGTGATTTGATAGGTAAGCAATTGCTTTCTAGTTGTAATCAAGCTCGATCGAGAAGCTGCTGCTGCTG[CTGCTGCTGG/CTGCTGCTGC,CTGCTGCTGCTGG,G,CTGCTGG,CTGCTGCTGCTG]
TGCTGCAGGTTTGGGTCCTGTACTTGCGTTTAGATATATAGTTCTGTTCGGCCCGTGTGAGACCCGCACCGAATTTATATAATTTTCGTGTCTCATATAG

Allele Frequencies:

Populations Population SizeFrequency of CCAGCAGCAG(primary allele) Frequency of CCAGCAGCAGCAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 2.90% 0.11% 0.00% GCAGCAGCAG: 2.60%; C: 0.34%; CAGCAGCAGCAG: 0.02%
All Indica  2759 93.30% 4.70% 0.14% 0.00% GCAGCAGCAG: 1.38%; C: 0.43%
All Japonica  1512 99.60% 0.20% 0.00% 0.00% GCAGCAGCAG: 0.13%; C: 0.07%
Aus  269 69.50% 0.00% 0.00% 0.00% GCAGCAGCAG: 29.37%; C: 0.74%; CAGCAGCAGCAG: 0.37%
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.20% 0.22% 0.00% GCAGCAGCAG: 0.22%
Indica III  913 88.70% 8.10% 0.11% 0.00% GCAGCAGCAG: 2.19%; C: 0.88%
Indica Intermediate  786 92.00% 5.10% 0.25% 0.00% GCAGCAGCAG: 2.16%; C: 0.51%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.00% GCAGCAGCAG: 0.20%
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.00% C: 0.41%; GCAGCAGCAG: 0.41%
VI/Aromatic  96 94.80% 1.00% 0.00% 0.00% GCAGCAGCAG: 4.17%
Intermediate  90 94.40% 3.30% 1.11% 0.00% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607502729 CCAGCAGCAG -> GCAGCAGCAG LOC_Os06g13580.1 upstream_gene_variant ; 2212.0bp to feature; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> GCAGCAGCAG LOC_Os06g13580-LOC_Os06g13590 intergenic_region ; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> CAGCAGCAGCAG LOC_Os06g13580.1 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> CAGCAGCAGCAG LOC_Os06g13580-LOC_Os06g13590 intergenic_region ; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> CCAGCAGCAGCAG LOC_Os06g13580.1 upstream_gene_variant ; 2222.0bp to feature; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> CCAGCAGCAGCAG LOC_Os06g13580-LOC_Os06g13590 intergenic_region ; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> CCAGCAG LOC_Os06g13580.1 upstream_gene_variant ; 2219.0bp to feature; MODIFIER N Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> CCAGCAG LOC_Os06g13580-LOC_Os06g13590 intergenic_region ; MODIFIER N Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> C LOC_Os06g13580.1 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N
vg0607502729 CCAGCAGCAG -> C LOC_Os06g13580-LOC_Os06g13590 intergenic_region ; MODIFIER silent_mutation Average:67.808; most accessible tissue: Callus, score: 93.365 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607502729 CCAGC* C 0.11 -0.18 -0.24 -0.36 -0.31 -0.36
vg0607502729 CCAGC* CAGCA* -0.1 -0.24 -0.19 0.0 -0.12 -0.24
vg0607502729 CCAGC* CCAGC* 0.25 -0.06 -0.14 -0.03 0.08 0.08
vg0607502729 CCAGC* GCAGC* -0.04 -0.05 -0.02 0.0 -0.03 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607502729 NA 1.58E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 NA 2.09E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 1.36E-07 9.72E-80 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 NA 1.00E-10 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 NA 2.64E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 NA 8.44E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 4.58E-11 6.60E-68 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 1.48E-09 4.50E-11 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 1.64E-19 1.41E-105 mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607502729 9.95E-17 9.04E-19 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251