\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607467410:

Variant ID: vg0607467410 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7467410
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTCCGGATGCTAGAGCTTGAGCAGGTGAGAGAGCTCCAGCCGGATGGCCTCGACGGATCCGCACAGGAAGGCTCGGGATTAGCTGCTCCGGTGGCTCG[T/C]
GAAGGAGCTCAGGCATAGCAGCATGGTGGCCTACTCTGGTGGGCGGGCGCCCGCTTGTCTTCCTCGGAGCGTGTACCCATCCTCCTTAGAGTGTGCTCGT

Reverse complement sequence

ACGAGCACACTCTAAGGAGGATGGGTACACGCTCCGAGGAAGACAAGCGGGCGCCCGCCCACCAGAGTAGGCCACCATGCTGCTATGCCTGAGCTCCTTC[A/G]
CGAGCCACCGGAGCAGCTAATCCCGAGCCTTCCTGTGCGGATCCGTCGAGGCCATCCGGCTGGAGCTCTCTCACCTGCTCAAGCTCTAGCATCCGGAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 41.10% 0.13% 0.17% NA
All Indica  2759 92.20% 7.30% 0.22% 0.25% NA
All Japonica  1512 1.50% 98.50% 0.00% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 96.10% 3.00% 0.50% 0.34% NA
Indica II  465 96.60% 3.00% 0.22% 0.22% NA
Indica III  913 90.10% 9.60% 0.00% 0.22% NA
Indica Intermediate  786 89.20% 10.30% 0.25% 0.25% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607467410 T -> C LOC_Os06g13540.1 upstream_gene_variant ; 2554.0bp to feature; MODIFIER silent_mutation Average:64.673; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0607467410 T -> C LOC_Os06g13530.1 downstream_gene_variant ; 1340.0bp to feature; MODIFIER silent_mutation Average:64.673; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0607467410 T -> C LOC_Os06g13520-LOC_Os06g13530 intergenic_region ; MODIFIER silent_mutation Average:64.673; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0607467410 T -> DEL N N silent_mutation Average:64.673; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607467410 NA 3.29E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 7.31E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 2.03E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 2.51E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 7.24E-18 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 7.14E-07 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 1.68E-31 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 1.10E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 5.84E-14 3.43E-84 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 2.62E-13 4.20E-21 mr1970 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 4.31E-15 2.18E-105 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 2.63E-13 5.70E-28 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 6.00E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 1.03E-08 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 4.14E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 NA 1.89E-24 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 8.09E-16 7.15E-83 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 2.11E-11 2.27E-26 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 2.19E-24 1.79E-136 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607467410 4.89E-17 5.35E-38 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251