Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0607428368:

Variant ID: vg0607428368 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7428368
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGTTTGCCACACCTCACTCTGTCACAAGTGTGTTATGCCATACAAAGTGAGACTAGCAATTTGTTAGCCACAAGTATAATTAAGTTTGGCAAGAATTT[G/A]
AGTATATGGCGTGCAGGCCCAATAATTTATAAAGTGAGGCATGATTTAGGTGTGGCAACTAACCAAATACTATACTAACAAATTATGGTATGCTTAACGT

Reverse complement sequence

ACGTTAAGCATACCATAATTTGTTAGTATAGTATTTGGTTAGTTGCCACACCTAAATCATGCCTCACTTTATAAATTATTGGGCCTGCACGCCATATACT[C/T]
AAATTCTTGCCAAACTTAATTATACTTGTGGCTAACAAATTGCTAGTCTCACTTTGTATGGCATAACACACTTGTGACAGAGTGAGGTGTGGCAAACTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.10%	5.80%	0.55%	48.62%	NA
All Indica	2759	10.80%	6.40%	0.94%	81.84%	NA
All Japonica	1512	99.00%	0.20%	0.00%	0.79%	NA
Aus	269	68.40%	31.20%	0.00%	0.37%	NA
Indica I	595	21.50%	2.90%	0.67%	74.96%	NA
Indica II	465	7.10%	0.60%	0.65%	91.61%	NA
Indica III	913	3.80%	10.60%	0.88%	84.67%	NA
Indica Intermediate	786	13.10%	7.50%	1.40%	77.99%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	99.00%	0.40%	0.00%	0.60%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	4.40%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607428368	G -> A	LOC_Os06g13480.1	downstream_gene_variant ; 4323.0bp to feature; MODIFIER	silent_mutation	Average:12.495; most accessible tissue: Callus, score: 46.574	N	N	N	N
vg0607428368	G -> A	LOC_Os06g13490.1	downstream_gene_variant ; 1362.0bp to feature; MODIFIER	silent_mutation	Average:12.495; most accessible tissue: Callus, score: 46.574	N	N	N	N
vg0607428368	G -> A	LOC_Os06g13480-LOC_Os06g13490	intergenic_region ; MODIFIER	silent_mutation	Average:12.495; most accessible tissue: Callus, score: 46.574	N	N	N	N
vg0607428368	G -> DEL	N	N	silent_mutation	Average:12.495; most accessible tissue: Callus, score: 46.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607428368	4.15E-06	3.44E-08	mr1177	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	7.86E-06	NA	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	4.53E-08	3.57E-14	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	3.04E-06	NA	mr1973	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	2.05E-09	9.95E-20	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	NA	8.50E-07	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	NA	1.83E-06	mr1708_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	9.18E-07	NA	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	1.81E-10	5.77E-18	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	1.28E-07	NA	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607428368	2.94E-17	8.74E-28	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251