Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607385204:

Variant ID: vg0607385204 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7385204
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTATGTATATATCTAATGTTGCAGTGAACTGAAACATTATTTCGCTATTTGCTGAAACATTGTTTTTTATATAAGGTGAAACAACACCTGATTTAAAC[G/A]
AGTGAAACATTTTCGATCTACTCAGTGAAACAATTCCGATATACCTGGTGGAACATCGTGAAACATTTAAAAATAATTCAATAATAAGTTAAAAAAATTC

Reverse complement sequence

GAATTTTTTTAACTTATTATTGAATTATTTTTAAATGTTTCACGATGTTCCACCAGGTATATCGGAATTGTTTCACTGAGTAGATCGAAAATGTTTCACT[C/T]
GTTTAAATCAGGTGTTGTTTCACCTTATATAAAAAACAATGTTTCAGCAAATAGCGAAATAATGTTTCAGTTCACTGCAACATTAGATATATACATAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.60%	5.10%	2.39%	44.94%	NA
All Indica	2759	16.70%	8.60%	3.55%	71.15%	NA
All Japonica	1512	98.70%	0.10%	0.00%	1.19%	NA
Aus	269	78.10%	0.40%	4.09%	17.47%	NA
Indica I	595	25.40%	3.00%	3.53%	68.07%	NA
Indica II	465	7.50%	0.90%	5.38%	86.24%	NA
Indica III	913	13.30%	18.20%	2.74%	65.83%	NA
Indica Intermediate	786	19.70%	6.10%	3.44%	70.74%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	99.00%	0.20%	0.00%	0.79%	NA
Japonica Intermediate	241	96.30%	0.00%	0.00%	3.73%	NA
VI/Aromatic	96	28.10%	0.00%	1.04%	70.83%	NA
Intermediate	90	63.30%	2.20%	3.33%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607385204	G -> A	LOC_Os06g13420.1	upstream_gene_variant ; 4314.0bp to feature; MODIFIER	silent_mutation	Average:8.82; most accessible tissue: Callus, score: 29.816	N	N	N	N
vg0607385204	G -> A	LOC_Os06g13430.1	upstream_gene_variant ; 3758.0bp to feature; MODIFIER	silent_mutation	Average:8.82; most accessible tissue: Callus, score: 29.816	N	N	N	N
vg0607385204	G -> A	LOC_Os06g13420-LOC_Os06g13430	intergenic_region ; MODIFIER	silent_mutation	Average:8.82; most accessible tissue: Callus, score: 29.816	N	N	N	N
vg0607385204	G -> DEL	N	N	silent_mutation	Average:8.82; most accessible tissue: Callus, score: 29.816	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607385204	NA	3.80E-09	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204	NA	2.70E-13	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204	4.53E-06	NA	mr1970_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204	NA	1.00E-11	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204	2.90E-08	NA	mr1973_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204	4.02E-11	2.20E-20	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251