\
| Variant ID: vg0607385204 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7385204 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACTATGTATATATCTAATGTTGCAGTGAACTGAAACATTATTTCGCTATTTGCTGAAACATTGTTTTTTATATAAGGTGAAACAACACCTGATTTAAAC[G/A]
AGTGAAACATTTTCGATCTACTCAGTGAAACAATTCCGATATACCTGGTGGAACATCGTGAAACATTTAAAAATAATTCAATAATAAGTTAAAAAAATTC
GAATTTTTTTAACTTATTATTGAATTATTTTTAAATGTTTCACGATGTTCCACCAGGTATATCGGAATTGTTTCACTGAGTAGATCGAAAATGTTTCACT[C/T]
GTTTAAATCAGGTGTTGTTTCACCTTATATAAAAAACAATGTTTCAGCAAATAGCGAAATAATGTTTCAGTTCACTGCAACATTAGATATATACATAGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.60% | 5.10% | 2.39% | 44.94% | NA |
| All Indica | 2759 | 16.70% | 8.60% | 3.55% | 71.15% | NA |
| All Japonica | 1512 | 98.70% | 0.10% | 0.00% | 1.19% | NA |
| Aus | 269 | 78.10% | 0.40% | 4.09% | 17.47% | NA |
| Indica I | 595 | 25.40% | 3.00% | 3.53% | 68.07% | NA |
| Indica II | 465 | 7.50% | 0.90% | 5.38% | 86.24% | NA |
| Indica III | 913 | 13.30% | 18.20% | 2.74% | 65.83% | NA |
| Indica Intermediate | 786 | 19.70% | 6.10% | 3.44% | 70.74% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 28.10% | 0.00% | 1.04% | 70.83% | NA |
| Intermediate | 90 | 63.30% | 2.20% | 3.33% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607385204 | G -> A | LOC_Os06g13420.1 | upstream_gene_variant ; 4314.0bp to feature; MODIFIER | silent_mutation | Average:8.82; most accessible tissue: Callus, score: 29.816 | N | N | N | N |
| vg0607385204 | G -> A | LOC_Os06g13430.1 | upstream_gene_variant ; 3758.0bp to feature; MODIFIER | silent_mutation | Average:8.82; most accessible tissue: Callus, score: 29.816 | N | N | N | N |
| vg0607385204 | G -> A | LOC_Os06g13420-LOC_Os06g13430 | intergenic_region ; MODIFIER | silent_mutation | Average:8.82; most accessible tissue: Callus, score: 29.816 | N | N | N | N |
| vg0607385204 | G -> DEL | N | N | silent_mutation | Average:8.82; most accessible tissue: Callus, score: 29.816 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607385204 | NA | 3.80E-09 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607385204 | NA | 2.70E-13 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607385204 | 4.53E-06 | NA | mr1970_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607385204 | NA | 1.00E-11 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607385204 | 2.90E-08 | NA | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607385204 | 4.02E-11 | 2.20E-20 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |