\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607385204:

Variant ID: vg0607385204 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7385204
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTATGTATATATCTAATGTTGCAGTGAACTGAAACATTATTTCGCTATTTGCTGAAACATTGTTTTTTATATAAGGTGAAACAACACCTGATTTAAAC[G/A]
AGTGAAACATTTTCGATCTACTCAGTGAAACAATTCCGATATACCTGGTGGAACATCGTGAAACATTTAAAAATAATTCAATAATAAGTTAAAAAAATTC

Reverse complement sequence

GAATTTTTTTAACTTATTATTGAATTATTTTTAAATGTTTCACGATGTTCCACCAGGTATATCGGAATTGTTTCACTGAGTAGATCGAAAATGTTTCACT[C/T]
GTTTAAATCAGGTGTTGTTTCACCTTATATAAAAAACAATGTTTCAGCAAATAGCGAAATAATGTTTCAGTTCACTGCAACATTAGATATATACATAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.60% 5.10% 2.39% 44.94% NA
All Indica  2759 16.70% 8.60% 3.55% 71.15% NA
All Japonica  1512 98.70% 0.10% 0.00% 1.19% NA
Aus  269 78.10% 0.40% 4.09% 17.47% NA
Indica I  595 25.40% 3.00% 3.53% 68.07% NA
Indica II  465 7.50% 0.90% 5.38% 86.24% NA
Indica III  913 13.30% 18.20% 2.74% 65.83% NA
Indica Intermediate  786 19.70% 6.10% 3.44% 70.74% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 99.00% 0.20% 0.00% 0.79% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 28.10% 0.00% 1.04% 70.83% NA
Intermediate  90 63.30% 2.20% 3.33% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607385204 G -> A LOC_Os06g13420.1 upstream_gene_variant ; 4314.0bp to feature; MODIFIER silent_mutation Average:8.82; most accessible tissue: Callus, score: 29.816 N N N N
vg0607385204 G -> A LOC_Os06g13430.1 upstream_gene_variant ; 3758.0bp to feature; MODIFIER silent_mutation Average:8.82; most accessible tissue: Callus, score: 29.816 N N N N
vg0607385204 G -> A LOC_Os06g13420-LOC_Os06g13430 intergenic_region ; MODIFIER silent_mutation Average:8.82; most accessible tissue: Callus, score: 29.816 N N N N
vg0607385204 G -> DEL N N silent_mutation Average:8.82; most accessible tissue: Callus, score: 29.816 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607385204 NA 3.80E-09 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204 NA 2.70E-13 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204 4.53E-06 NA mr1970_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204 NA 1.00E-11 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204 2.90E-08 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607385204 4.02E-11 2.20E-20 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251