\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607383997:

Variant ID: vg0607383997 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7383997
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTGTTAGATGATAAAACATGAATAATACTTTATGCGTGGCTTATCTTTTTAAATTTTTTTATAATTTTTTAAAATAAAACGGACGGTCAAACGTTGGA[C/T]
ACGGAAACCAAGAATTAAGTTATTTTGGGACGGATGGAGTACATAGCAGGACGACCGGGTTTAATTGCATCCTCGGACGTACGAGAGAGGTTCAATTATT

Reverse complement sequence

AATAATTGAACCTCTCTCGTACGTCCGAGGATGCAATTAAACCCGGTCGTCCTGCTATGTACTCCATCCGTCCCAAAATAACTTAATTCTTGGTTTCCGT[G/A]
TCCAACGTTTGACCGTCCGTTTTATTTTAAAAAATTATAAAAAAATTTAAAAAGATAAGCCACGCATAAAGTATTATTCATGTTTTATCATCTAACAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 9.80% 3.20% 42.59% NA
All Indica  2759 12.60% 10.80% 5.00% 71.55% NA
All Japonica  1512 98.50% 0.70% 0.07% 0.79% NA
Aus  269 68.40% 29.40% 1.86% 0.37% NA
Indica I  595 5.50% 19.20% 4.20% 71.09% NA
Indica II  465 5.60% 6.70% 7.10% 80.65% NA
Indica III  913 20.40% 7.70% 5.37% 66.59% NA
Indica Intermediate  786 13.10% 10.70% 3.94% 72.26% NA
Temperate Japonica  767 98.80% 0.50% 0.00% 0.65% NA
Tropical Japonica  504 99.20% 0.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 2.10% 0.41% 1.66% NA
VI/Aromatic  96 27.10% 70.80% 2.08% 0.00% NA
Intermediate  90 58.90% 6.70% 5.56% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607383997 C -> T LOC_Os06g13420.1 upstream_gene_variant ; 3107.0bp to feature; MODIFIER silent_mutation Average:64.001; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0607383997 C -> T LOC_Os06g13430.1 upstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:64.001; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0607383997 C -> T LOC_Os06g13420-LOC_Os06g13430 intergenic_region ; MODIFIER silent_mutation Average:64.001; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0607383997 C -> DEL N N silent_mutation Average:64.001; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607383997 NA 4.84E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 2.89E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 2.03E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 6.15E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 1.39E-29 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 5.47E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 1.93E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 2.25E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 1.32E-19 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 5.69E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 6.78E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 1.84E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 1.01E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 3.04E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 2.72E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 4.24E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 2.78E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 5.51E-33 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 2.58E-11 3.38E-80 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 1.13E-11 1.31E-21 mr1970 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 1.28E-17 2.31E-108 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 6.31E-17 9.77E-35 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 3.03E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 6.79E-09 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 7.97E-06 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 NA 2.35E-24 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 1.38E-14 1.64E-80 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 1.27E-10 2.02E-26 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 2.53E-22 1.44E-132 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383997 1.51E-19 7.53E-41 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251