\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607383125:

Variant ID: vg0607383125 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7383125
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCCACTGTTAGAGAGCGATTTTTTCTTCCCAATCGCTGTCTTCGCTCTCTCGCGCGCGCTGGGAGAAAATGTTCCCGTGCTCCTTTTCTCGCCCTACT[C/T]
GCGAGCAGCCATCATCGTCTCCCTCACAAGCGTCGGCGGCATTGGAGGGGATGGAGGAGCTGGCAGAGGGGAATCGAGGGAGATCAGCAACCAACAGACG

Reverse complement sequence

CGTCTGTTGGTTGCTGATCTCCCTCGATTCCCCTCTGCCAGCTCCTCCATCCCCTCCAATGCCGCCGACGCTTGTGAGGGAGACGATGATGGCTGCTCGC[G/A]
AGTAGGGCGAGAAAAGGAGCACGGGAACATTTTCTCCCAGCGCGCGCGAGAGAGCGAAGACAGCGATTGGGAAGAAAAAATCGCTCTCTAACAGTGGGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 16.70% 2.16% 0.00% NA
All Indica  2759 87.90% 11.70% 0.33% 0.00% NA
All Japonica  1512 65.90% 28.30% 5.82% 0.00% NA
Aus  269 97.40% 1.90% 0.74% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 77.20% 22.60% 0.22% 0.00% NA
Indica Intermediate  786 88.50% 10.70% 0.76% 0.00% NA
Temperate Japonica  767 88.00% 4.40% 7.56% 0.00% NA
Tropical Japonica  504 28.60% 68.10% 3.37% 0.00% NA
Japonica Intermediate  241 73.40% 21.20% 5.39% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607383125 C -> T LOC_Os06g13420.1 upstream_gene_variant ; 2235.0bp to feature; MODIFIER silent_mutation Average:58.684; most accessible tissue: Zhenshan97 flower, score: 83.709 N N N N
vg0607383125 C -> T LOC_Os06g13420-LOC_Os06g13430 intergenic_region ; MODIFIER silent_mutation Average:58.684; most accessible tissue: Zhenshan97 flower, score: 83.709 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607383125 NA 7.07E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 NA 3.00E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 NA 2.83E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 NA 1.92E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 NA 8.30E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 5.63E-11 4.12E-20 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 1.07E-14 1.09E-31 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 NA 2.54E-09 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 1.95E-06 NA mr1970_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 1.09E-17 2.54E-29 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125 8.25E-33 6.20E-47 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251