Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607383125:

Variant ID: vg0607383125 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7383125
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACCCACTGTTAGAGAGCGATTTTTTCTTCCCAATCGCTGTCTTCGCTCTCTCGCGCGCGCTGGGAGAAAATGTTCCCGTGCTCCTTTTCTCGCCCTACT[C/T]
GCGAGCAGCCATCATCGTCTCCCTCACAAGCGTCGGCGGCATTGGAGGGGATGGAGGAGCTGGCAGAGGGGAATCGAGGGAGATCAGCAACCAACAGACG

Reverse complement sequence

CGTCTGTTGGTTGCTGATCTCCCTCGATTCCCCTCTGCCAGCTCCTCCATCCCCTCCAATGCCGCCGACGCTTGTGAGGGAGACGATGATGGCTGCTCGC[G/A]
AGTAGGGCGAGAAAAGGAGCACGGGAACATTTTCTCCCAGCGCGCGCGAGAGAGCGAAGACAGCGATTGGGAAGAAAAAATCGCTCTCTAACAGTGGGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	16.70%	2.16%	0.00%	NA
All Indica	2759	87.90%	11.70%	0.33%	0.00%	NA
All Japonica	1512	65.90%	28.30%	5.82%	0.00%	NA
Aus	269	97.40%	1.90%	0.74%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	96.10%	3.70%	0.22%	0.00%	NA
Indica III	913	77.20%	22.60%	0.22%	0.00%	NA
Indica Intermediate	786	88.50%	10.70%	0.76%	0.00%	NA
Temperate Japonica	767	88.00%	4.40%	7.56%	0.00%	NA
Tropical Japonica	504	28.60%	68.10%	3.37%	0.00%	NA
Japonica Intermediate	241	73.40%	21.20%	5.39%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	71.10%	25.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607383125	C -> T	LOC_Os06g13420.1	upstream_gene_variant ; 2235.0bp to feature; MODIFIER	silent_mutation	Average:58.684; most accessible tissue: Zhenshan97 flower, score: 83.709	N	N	N	N
vg0607383125	C -> T	LOC_Os06g13420-LOC_Os06g13430	intergenic_region ; MODIFIER	silent_mutation	Average:58.684; most accessible tissue: Zhenshan97 flower, score: 83.709	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607383125	NA	7.07E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	NA	3.00E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	NA	2.83E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	NA	1.92E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	NA	8.30E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	5.63E-11	4.12E-20	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	1.07E-14	1.09E-31	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	NA	2.54E-09	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	1.95E-06	NA	mr1970_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	1.09E-17	2.54E-29	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607383125	8.25E-33	6.20E-47	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251