\
| Variant ID: vg0607378867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7378867 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGGTCGCATTATTTTATTATTTCCAGGGATAAAAGAGGTGAGATAGTTTTCTAAATACCCGGATTGCCCCTTCTCTTTCCTTCTTTTTCTCCTTCTCCTT[T/C]
CTTCTTTTCCCCCTTCCCGTTGACATCGTCGGGAACGGCATGACGGCCTCAGAGAGCAGTGGGGCGAGGTCAGCACGACGTGGTGCGATAACACTGGTGG
CCACCAGTGTTATCGCACCACGTCGTGCTGACCTCGCCCCACTGCTCTCTGAGGCCGTCATGCCGTTCCCGACGATGTCAACGGGAAGGGGGAAAAGAAG[A/G]
AAGGAGAAGGAGAAAAAGAAGGAAAGAGAAGGGGCAATCCGGGTATTTAGAAAACTATCTCACCTCTTTTATCCCTGGAAATAATAAAATAATGCGACCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 0.60% | 0.76% | 58.97% | NA |
| All Indica | 2759 | 4.60% | 0.20% | 0.58% | 94.60% | NA |
| All Japonica | 1512 | 98.40% | 0.10% | 0.07% | 1.39% | NA |
| Aus | 269 | 69.10% | 0.00% | 4.46% | 26.39% | NA |
| Indica I | 595 | 4.00% | 0.00% | 0.34% | 95.63% | NA |
| Indica II | 465 | 4.10% | 0.20% | 0.22% | 95.48% | NA |
| Indica III | 913 | 3.20% | 0.10% | 0.66% | 96.06% | NA |
| Indica Intermediate | 786 | 7.10% | 0.40% | 0.89% | 91.60% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.80% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 27.10% | 16.70% | 6.25% | 50.00% | NA |
| Intermediate | 90 | 54.40% | 3.30% | 1.11% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607378867 | T -> C | LOC_Os06g13420.1 | missense_variant ; p.Glu236Gly; MODERATE | nonsynonymous_codon ; E236G | Average:26.613; most accessible tissue: Callus, score: 44.026 | unknown | unknown | TOLERATED | 0.57 |
| vg0607378867 | T -> DEL | LOC_Os06g13420.1 | N | frameshift_variant | Average:26.613; most accessible tissue: Callus, score: 44.026 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607378867 | 3.04E-07 | NA | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | 2.30E-06 | 3.54E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | NA | 2.98E-06 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | NA | 9.34E-14 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | NA | 9.92E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | 8.20E-07 | NA | mr1728_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | NA | 5.18E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | 3.95E-06 | NA | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | NA | 4.52E-07 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | 3.75E-06 | NA | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | 1.05E-08 | NA | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378867 | 2.02E-06 | 3.23E-10 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |