Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607378048:

Variant ID: vg0607378048 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7378048
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, A: 0.20, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAATTGCGAGACGAATCTTTAAGCCTAATTGCGCCATGATTTAACGATGTGGTACAAACATTTGCTAATAATGGATTAATTAGGCTTAATAAATTCGT[A/C]
TCGCAGTTTCCTGACGTAATCTATAATTTGTTTTGTCATTAGACTACGTTTAATATCCGATGTGACAATCAAACCCAAATTTTTTTCCAACTAAACAAGT

Reverse complement sequence

ACTTGTTTAGTTGGAAAAAAATTTGGGTTTGATTGTCACATCGGATATTAAACGTAGTCTAATGACAAAACAAATTATAGATTACGTCAGGAAACTGCGA[T/G]
ACGAATTTATTAAGCCTAATTAATCCATTATTAGCAAATGTTTGTACCACATCGTTAAATCATGGCGCAATTAGGCTTAAAGATTCGTCTCGCAATTTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.60%	1.00%	1.02%	59.44%	NA
All Indica	2759	4.10%	0.20%	0.58%	95.14%	NA
All Japonica	1512	96.20%	2.30%	0.07%	1.46%	NA
Aus	269	68.00%	0.00%	0.74%	31.23%	NA
Indica I	595	3.00%	0.00%	0.84%	96.13%	NA
Indica II	465	4.30%	0.40%	0.65%	94.62%	NA
Indica III	913	2.60%	0.00%	0.22%	97.15%	NA
Indica Intermediate	786	6.50%	0.40%	0.76%	92.37%	NA
Temperate Japonica	767	98.40%	0.40%	0.00%	1.17%	NA
Tropical Japonica	504	98.60%	0.60%	0.00%	0.79%	NA
Japonica Intermediate	241	83.80%	12.00%	0.41%	3.73%	NA
VI/Aromatic	96	27.10%	1.00%	26.04%	45.83%	NA
Intermediate	90	53.30%	4.40%	4.44%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607378048	A -> C	LOC_Os06g13410.1	upstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:20.648; most accessible tissue: Callus, score: 50.25	N	N	N	N
vg0607378048	A -> C	LOC_Os06g13420.1	downstream_gene_variant ; 650.0bp to feature; MODIFIER	silent_mutation	Average:20.648; most accessible tissue: Callus, score: 50.25	N	N	N	N
vg0607378048	A -> C	LOC_Os06g13410-LOC_Os06g13420	intergenic_region ; MODIFIER	silent_mutation	Average:20.648; most accessible tissue: Callus, score: 50.25	N	N	N	N
vg0607378048	A -> DEL	N	N	silent_mutation	Average:20.648; most accessible tissue: Callus, score: 50.25	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607378048	7.16E-07	NA	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	1.04E-06	1.46E-06	mr1707	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	NA	1.54E-07	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	1.16E-06	NA	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	NA	2.75E-06	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	NA	5.69E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	1.56E-06	NA	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	NA	3.97E-07	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	9.20E-10	NA	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048	1.52E-07	1.85E-12	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251