\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607378048:

Variant ID: vg0607378048 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7378048
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, A: 0.20, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAATTGCGAGACGAATCTTTAAGCCTAATTGCGCCATGATTTAACGATGTGGTACAAACATTTGCTAATAATGGATTAATTAGGCTTAATAAATTCGT[A/C]
TCGCAGTTTCCTGACGTAATCTATAATTTGTTTTGTCATTAGACTACGTTTAATATCCGATGTGACAATCAAACCCAAATTTTTTTCCAACTAAACAAGT

Reverse complement sequence

ACTTGTTTAGTTGGAAAAAAATTTGGGTTTGATTGTCACATCGGATATTAAACGTAGTCTAATGACAAAACAAATTATAGATTACGTCAGGAAACTGCGA[T/G]
ACGAATTTATTAAGCCTAATTAATCCATTATTAGCAAATGTTTGTACCACATCGTTAAATCATGGCGCAATTAGGCTTAAAGATTCGTCTCGCAATTTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 1.00% 1.02% 59.44% NA
All Indica  2759 4.10% 0.20% 0.58% 95.14% NA
All Japonica  1512 96.20% 2.30% 0.07% 1.46% NA
Aus  269 68.00% 0.00% 0.74% 31.23% NA
Indica I  595 3.00% 0.00% 0.84% 96.13% NA
Indica II  465 4.30% 0.40% 0.65% 94.62% NA
Indica III  913 2.60% 0.00% 0.22% 97.15% NA
Indica Intermediate  786 6.50% 0.40% 0.76% 92.37% NA
Temperate Japonica  767 98.40% 0.40% 0.00% 1.17% NA
Tropical Japonica  504 98.60% 0.60% 0.00% 0.79% NA
Japonica Intermediate  241 83.80% 12.00% 0.41% 3.73% NA
VI/Aromatic  96 27.10% 1.00% 26.04% 45.83% NA
Intermediate  90 53.30% 4.40% 4.44% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607378048 A -> C LOC_Os06g13410.1 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:20.648; most accessible tissue: Callus, score: 50.25 N N N N
vg0607378048 A -> C LOC_Os06g13420.1 downstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:20.648; most accessible tissue: Callus, score: 50.25 N N N N
vg0607378048 A -> C LOC_Os06g13410-LOC_Os06g13420 intergenic_region ; MODIFIER silent_mutation Average:20.648; most accessible tissue: Callus, score: 50.25 N N N N
vg0607378048 A -> DEL N N silent_mutation Average:20.648; most accessible tissue: Callus, score: 50.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607378048 7.16E-07 NA mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 1.04E-06 1.46E-06 mr1707 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 NA 1.54E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 1.16E-06 NA mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 NA 2.75E-06 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 NA 5.69E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 1.56E-06 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 NA 3.97E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 9.20E-10 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607378048 1.52E-07 1.85E-12 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251