\
| Variant ID: vg0607378048 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7378048 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, A: 0.20, others allele: 0.00, population size: 89. )
GTAAATTGCGAGACGAATCTTTAAGCCTAATTGCGCCATGATTTAACGATGTGGTACAAACATTTGCTAATAATGGATTAATTAGGCTTAATAAATTCGT[A/C]
TCGCAGTTTCCTGACGTAATCTATAATTTGTTTTGTCATTAGACTACGTTTAATATCCGATGTGACAATCAAACCCAAATTTTTTTCCAACTAAACAAGT
ACTTGTTTAGTTGGAAAAAAATTTGGGTTTGATTGTCACATCGGATATTAAACGTAGTCTAATGACAAAACAAATTATAGATTACGTCAGGAAACTGCGA[T/G]
ACGAATTTATTAAGCCTAATTAATCCATTATTAGCAAATGTTTGTACCACATCGTTAAATCATGGCGCAATTAGGCTTAAAGATTCGTCTCGCAATTTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 1.00% | 1.02% | 59.44% | NA |
| All Indica | 2759 | 4.10% | 0.20% | 0.58% | 95.14% | NA |
| All Japonica | 1512 | 96.20% | 2.30% | 0.07% | 1.46% | NA |
| Aus | 269 | 68.00% | 0.00% | 0.74% | 31.23% | NA |
| Indica I | 595 | 3.00% | 0.00% | 0.84% | 96.13% | NA |
| Indica II | 465 | 4.30% | 0.40% | 0.65% | 94.62% | NA |
| Indica III | 913 | 2.60% | 0.00% | 0.22% | 97.15% | NA |
| Indica Intermediate | 786 | 6.50% | 0.40% | 0.76% | 92.37% | NA |
| Temperate Japonica | 767 | 98.40% | 0.40% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 98.60% | 0.60% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 83.80% | 12.00% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 27.10% | 1.00% | 26.04% | 45.83% | NA |
| Intermediate | 90 | 53.30% | 4.40% | 4.44% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607378048 | A -> C | LOC_Os06g13410.1 | upstream_gene_variant ; 1116.0bp to feature; MODIFIER | silent_mutation | Average:20.648; most accessible tissue: Callus, score: 50.25 | N | N | N | N |
| vg0607378048 | A -> C | LOC_Os06g13420.1 | downstream_gene_variant ; 650.0bp to feature; MODIFIER | silent_mutation | Average:20.648; most accessible tissue: Callus, score: 50.25 | N | N | N | N |
| vg0607378048 | A -> C | LOC_Os06g13410-LOC_Os06g13420 | intergenic_region ; MODIFIER | silent_mutation | Average:20.648; most accessible tissue: Callus, score: 50.25 | N | N | N | N |
| vg0607378048 | A -> DEL | N | N | silent_mutation | Average:20.648; most accessible tissue: Callus, score: 50.25 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607378048 | 7.16E-07 | NA | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | 1.04E-06 | 1.46E-06 | mr1707 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | NA | 1.54E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | 1.16E-06 | NA | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | NA | 2.75E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | NA | 5.69E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | 1.56E-06 | NA | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | NA | 3.97E-07 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | 9.20E-10 | NA | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607378048 | 1.52E-07 | 1.85E-12 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |