\
| Variant ID: vg0607375701 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7375701 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTGCCATGATTTGACAATGTGTTACAAACATTTACTAATGATGGATTAATTAGTCTTAATAAATTCGTCTTGCAGTTTCCTGACGGAATCTATAATTT[G/A]
TTTTCTTATTAGGCTACGTTTAATACTTTAAATGTGTGTCTGTATATCTGACGTGATAATCAAACCTAAAATTTTCTCGACTAAACAAGGCCTTAATGGT
ACCATTAAGGCCTTGTTTAGTCGAGAAAATTTTAGGTTTGATTATCACGTCAGATATACAGACACACATTTAAAGTATTAAACGTAGCCTAATAAGAAAA[C/T]
AAATTATAGATTCCGTCAGGAAACTGCAAGACGAATTTATTAAGACTAATTAATCCATCATTAGTAAATGTTTGTAACACATTGTCAAATCATGGCACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 1.40% | 0.80% | 5.88% | NA |
| All Indica | 2759 | 89.60% | 0.20% | 0.25% | 9.97% | NA |
| All Japonica | 1512 | 94.40% | 3.60% | 1.92% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.00% | 0.00% | 0.17% | 2.86% | NA |
| Indica II | 465 | 98.10% | 0.20% | 0.22% | 1.51% | NA |
| Indica III | 913 | 78.90% | 0.10% | 0.11% | 20.92% | NA |
| Indica Intermediate | 786 | 91.50% | 0.40% | 0.51% | 7.63% | NA |
| Temperate Japonica | 767 | 94.30% | 3.00% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 4.20% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 93.80% | 4.60% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607375701 | G -> A | LOC_Os06g13390.1 | upstream_gene_variant ; 3919.0bp to feature; MODIFIER | silent_mutation | Average:29.998; most accessible tissue: Callus, score: 65.504 | N | N | N | N |
| vg0607375701 | G -> A | LOC_Os06g13410.1 | downstream_gene_variant ; 585.0bp to feature; MODIFIER | silent_mutation | Average:29.998; most accessible tissue: Callus, score: 65.504 | N | N | N | N |
| vg0607375701 | G -> A | LOC_Os06g13420.1 | downstream_gene_variant ; 2997.0bp to feature; MODIFIER | silent_mutation | Average:29.998; most accessible tissue: Callus, score: 65.504 | N | N | N | N |
| vg0607375701 | G -> A | LOC_Os06g13390-LOC_Os06g13410 | intergenic_region ; MODIFIER | silent_mutation | Average:29.998; most accessible tissue: Callus, score: 65.504 | N | N | N | N |
| vg0607375701 | G -> DEL | N | N | silent_mutation | Average:29.998; most accessible tissue: Callus, score: 65.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607375701 | NA | 3.26E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607375701 | NA | 8.78E-09 | mr1510_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607375701 | NA | 7.69E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |