\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607375701:

Variant ID: vg0607375701 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7375701
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGCCATGATTTGACAATGTGTTACAAACATTTACTAATGATGGATTAATTAGTCTTAATAAATTCGTCTTGCAGTTTCCTGACGGAATCTATAATTT[G/A]
TTTTCTTATTAGGCTACGTTTAATACTTTAAATGTGTGTCTGTATATCTGACGTGATAATCAAACCTAAAATTTTCTCGACTAAACAAGGCCTTAATGGT

Reverse complement sequence

ACCATTAAGGCCTTGTTTAGTCGAGAAAATTTTAGGTTTGATTATCACGTCAGATATACAGACACACATTTAAAGTATTAAACGTAGCCTAATAAGAAAA[C/T]
AAATTATAGATTCCGTCAGGAAACTGCAAGACGAATTTATTAAGACTAATTAATCCATCATTAGTAAATGTTTGTAACACATTGTCAAATCATGGCACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 1.40% 0.80% 5.88% NA
All Indica  2759 89.60% 0.20% 0.25% 9.97% NA
All Japonica  1512 94.40% 3.60% 1.92% 0.07% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.00% 0.00% 0.17% 2.86% NA
Indica II  465 98.10% 0.20% 0.22% 1.51% NA
Indica III  913 78.90% 0.10% 0.11% 20.92% NA
Indica Intermediate  786 91.50% 0.40% 0.51% 7.63% NA
Temperate Japonica  767 94.30% 3.00% 2.74% 0.00% NA
Tropical Japonica  504 94.80% 4.20% 0.79% 0.20% NA
Japonica Intermediate  241 93.80% 4.60% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607375701 G -> A LOC_Os06g13390.1 upstream_gene_variant ; 3919.0bp to feature; MODIFIER silent_mutation Average:29.998; most accessible tissue: Callus, score: 65.504 N N N N
vg0607375701 G -> A LOC_Os06g13410.1 downstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:29.998; most accessible tissue: Callus, score: 65.504 N N N N
vg0607375701 G -> A LOC_Os06g13420.1 downstream_gene_variant ; 2997.0bp to feature; MODIFIER silent_mutation Average:29.998; most accessible tissue: Callus, score: 65.504 N N N N
vg0607375701 G -> A LOC_Os06g13390-LOC_Os06g13410 intergenic_region ; MODIFIER silent_mutation Average:29.998; most accessible tissue: Callus, score: 65.504 N N N N
vg0607375701 G -> DEL N N silent_mutation Average:29.998; most accessible tissue: Callus, score: 65.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607375701 NA 3.26E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375701 NA 8.78E-09 mr1510_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375701 NA 7.69E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251