\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607375453:

Variant ID: vg0607375453 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7375453
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCCAAATCATCCGAGCTCAGCGCCATACTACATGGCACTGAGAGCTTCATAGGATAAAACCATAACCATGCACTTTGATTTACAAAAGGTTTGCTTGG[A/C]
TTAGGCCTTGTCTAGTTTCCAAAACAAAAACTTTTTACCCATCACATCAAATGTTTGGACACATGTATGGAGTACTAAATATGGACAAAATAAAAAACTA

Reverse complement sequence

TAGTTTTTTATTTTGTCCATATTTAGTACTCCATACATGTGTCCAAACATTTGATGTGATGGGTAAAAAGTTTTTGTTTTGGAAACTAGACAAGGCCTAA[T/G]
CCAAGCAAACCTTTTGTAAATCAAAGTGCATGGTTATGGTTTTATCCTATGAAGCTCTCAGTGCCATGTAGTATGGCGCTGAGCTCGGATGATTTGGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 37.80% 0.13% 5.78% NA
All Indica  2759 87.10% 2.90% 0.22% 9.79% NA
All Japonica  1512 3.80% 96.10% 0.00% 0.07% NA
Aus  269 32.30% 67.70% 0.00% 0.00% NA
Indica I  595 96.00% 1.30% 0.00% 2.69% NA
Indica II  465 95.90% 3.00% 0.00% 1.08% NA
Indica III  913 77.30% 1.90% 0.33% 20.48% NA
Indica Intermediate  786 86.60% 5.10% 0.38% 7.89% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.00% 0.20% NA
Japonica Intermediate  241 16.20% 83.80% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607375453 A -> C LOC_Os06g13390.1 upstream_gene_variant ; 3671.0bp to feature; MODIFIER silent_mutation Average:39.638; most accessible tissue: Callus, score: 70.249 N N N N
vg0607375453 A -> C LOC_Os06g13410.1 downstream_gene_variant ; 833.0bp to feature; MODIFIER silent_mutation Average:39.638; most accessible tissue: Callus, score: 70.249 N N N N
vg0607375453 A -> C LOC_Os06g13420.1 downstream_gene_variant ; 3245.0bp to feature; MODIFIER silent_mutation Average:39.638; most accessible tissue: Callus, score: 70.249 N N N N
vg0607375453 A -> C LOC_Os06g13390-LOC_Os06g13410 intergenic_region ; MODIFIER silent_mutation Average:39.638; most accessible tissue: Callus, score: 70.249 N N N N
vg0607375453 A -> DEL N N silent_mutation Average:39.638; most accessible tissue: Callus, score: 70.249 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607375453 NA 1.54E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 4.51E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 6.98E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 2.19E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.31E-19 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 3.87E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 7.23E-35 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 4.28E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 5.27E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 3.55E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 3.13E-06 NA mr1702 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.88E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 3.78E-33 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.93E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.15E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 5.45E-74 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 3.58E-12 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 1.57E-07 6.71E-99 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 3.92E-18 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 8.81E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.78E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 2.33E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.09E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 5.95E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 2.27E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 3.30E-08 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 1.88E-13 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 2.12E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 7.73E-07 1.54E-75 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 NA 2.50E-17 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 1.95E-12 1.31E-126 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607375453 6.71E-10 2.37E-28 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251