Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607367426:

Variant ID: vg0607367426 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7367426
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAAATTCAGTCTAGTTTTAGTAAGGCCAAGTAAGGTTGTGTTCGTGCCGGTCGACGTCATCGTCAACGCCATCATGCAAAAAAATGAAGGAGGAGAGGC[G/A]
CAAGCACGAGGTGGTGGCGCTGTACGAGCTAGGGCTTCGACATGCTGGTGTTGGGGGTGGCACTGTTCGAGAGGGCTCCTCGCCGCAGGTCTCACACAAA

Reverse complement sequence

TTTGTGTGAGACCTGCGGCGAGGAGCCCTCTCGAACAGTGCCACCCCCAACACCAGCATGTCGAAGCCCTAGCTCGTACAGCGCCACCACCTCGTGCTTG[C/T]
GCCTCTCCTCCTTCATTTTTTTGCATGATGGCGTTGACGATGACGTCGACCGGCACGAACACAACCTTACTTGGCCTTACTAAAACTAGACTGAATTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	6.60%	0.44%	7.87%	NA
All Indica	2759	89.10%	0.50%	0.04%	10.40%	NA
All Japonica	1512	90.70%	8.00%	1.06%	0.20%	NA
Aus	269	6.30%	63.60%	1.49%	28.62%	NA
Indica I	595	97.00%	0.00%	0.17%	2.86%	NA
Indica II	465	98.90%	0.00%	0.00%	1.08%	NA
Indica III	913	78.80%	0.10%	0.00%	21.14%	NA
Indica Intermediate	786	89.20%	1.70%	0.00%	9.16%	NA
Temperate Japonica	767	98.60%	0.40%	1.04%	0.00%	NA
Tropical Japonica	504	77.00%	21.40%	1.19%	0.40%	NA
Japonica Intermediate	241	94.60%	4.10%	0.83%	0.41%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	92.20%	6.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607367426	G -> A	LOC_Os06g13370.1	downstream_gene_variant ; 1267.0bp to feature; MODIFIER	silent_mutation	Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0607367426	G -> A	LOC_Os06g13380.1	downstream_gene_variant ; 365.0bp to feature; MODIFIER	silent_mutation	Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0607367426	G -> A	LOC_Os06g13390.1	downstream_gene_variant ; 1711.0bp to feature; MODIFIER	silent_mutation	Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0607367426	G -> A	LOC_Os06g13370-LOC_Os06g13380	intergenic_region ; MODIFIER	silent_mutation	Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0607367426	G -> DEL	N	N	silent_mutation	Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607367426	NA	3.64E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.07E-09	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	8.64E-17	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	2.59E-08	1.43E-26	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	4.39E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	7.84E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	3.17E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	5.15E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	7.53E-09	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	1.08E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	6.90E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.10E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.58E-08	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.46E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.19E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	9.81E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	7.01E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.26E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	3.82E-09	mr1634	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	1.80E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	4.79E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	6.29E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	3.99E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.13E-06	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	4.69E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	4.92E-07	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	2.68E-08	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	1.15E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	6.38E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607367426	NA	5.84E-17	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251