\
| Variant ID: vg0607317396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7317396 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGACTGAGAAGAATGAGAGGAGGATTTAACACGAAAAAGAGAGGAAGGGGTGGACGTGCAGCAAACCGACTAAATTTTCATATGCGGTTCTCTTAACAAG[C/T]
CCGTCTACGCAAATAAACCTATTTTCACAAGTGGGTTTGTTAAGAGATCCGCATATGAAAATTGATTTTCGTAGGCATGCTATTATTAGACATTTTCTAA
TTAGAAAATGTCTAATAATAGCATGCCTACGAAAATCAATTTTCATATGCGGATCTCTTAACAAACCCACTTGTGAAAATAGGTTTATTTGCGTAGACGG[G/A]
CTTGTTAAGAGAACCGCATATGAAAATTTAGTCGGTTTGCTGCACGTCCACCCCTTCCTCTCTTTTTCGTGTTAAATCCTCCTCTCATTCTTCTCAGTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.00% | 0.30% | 0.32% | 1.46% | NA |
| All Indica | 2759 | 99.10% | 0.40% | 0.40% | 0.11% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 98.10% | 0.40% | 1.29% | 0.22% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.70% | 0.90% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 35.40% | 0.00% | 4.17% | 60.42% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607317396 | C -> T | LOC_Os06g13290.1 | downstream_gene_variant ; 4319.0bp to feature; MODIFIER | silent_mutation | Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg0607317396 | C -> T | LOC_Os06g13310.1 | downstream_gene_variant ; 1203.0bp to feature; MODIFIER | silent_mutation | Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg0607317396 | C -> T | LOC_Os06g13290-LOC_Os06g13310 | intergenic_region ; MODIFIER | silent_mutation | Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg0607317396 | C -> DEL | N | N | silent_mutation | Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607317396 | 3.63E-06 | NA | mr1251 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607317396 | 3.86E-06 | NA | mr1251 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607317396 | NA | 7.14E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607317396 | 6.39E-06 | NA | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607317396 | NA | 2.44E-08 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |