\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607317396:

Variant ID: vg0607317396 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7317396
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACTGAGAAGAATGAGAGGAGGATTTAACACGAAAAAGAGAGGAAGGGGTGGACGTGCAGCAAACCGACTAAATTTTCATATGCGGTTCTCTTAACAAG[C/T]
CCGTCTACGCAAATAAACCTATTTTCACAAGTGGGTTTGTTAAGAGATCCGCATATGAAAATTGATTTTCGTAGGCATGCTATTATTAGACATTTTCTAA

Reverse complement sequence

TTAGAAAATGTCTAATAATAGCATGCCTACGAAAATCAATTTTCATATGCGGATCTCTTAACAAACCCACTTGTGAAAATAGGTTTATTTGCGTAGACGG[G/A]
CTTGTTAAGAGAACCGCATATGAAAATTTAGTCGGTTTGCTGCACGTCCACCCCTTCCTCTCTTTTTCGTGTTAAATCCTCCTCTCATTCTTCTCAGTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 0.30% 0.32% 1.46% NA
All Indica  2759 99.10% 0.40% 0.40% 0.11% NA
All Japonica  1512 99.70% 0.00% 0.00% 0.26% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 98.10% 0.40% 1.29% 0.22% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 98.70% 0.90% 0.25% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 35.40% 0.00% 4.17% 60.42% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607317396 C -> T LOC_Os06g13290.1 downstream_gene_variant ; 4319.0bp to feature; MODIFIER silent_mutation Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0607317396 C -> T LOC_Os06g13310.1 downstream_gene_variant ; 1203.0bp to feature; MODIFIER silent_mutation Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0607317396 C -> T LOC_Os06g13290-LOC_Os06g13310 intergenic_region ; MODIFIER silent_mutation Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0607317396 C -> DEL N N silent_mutation Average:60.358; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607317396 3.63E-06 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607317396 3.86E-06 NA mr1251 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607317396 NA 7.14E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607317396 6.39E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607317396 NA 2.44E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251