\
| Variant ID: vg0607310239 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7310239 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 241. )
TGATCGGAAAATTTGCCGACAAGCATTCAAATACATGTTGCTTGATGGAGATCTATATCGCTGAAACATAGAGGGAGTATTATTAAAGTGCTTAGACAAT[G/A]
ATCAATCTAAGGTTGCTATGGGTGAAGTTCATGAAGGAATTTGTGGAACTCATCAGTCGGCCCATAAGATGAATTGGTTACTTAGGAGAGCGGGATTCTA
TAGAATCCCGCTCTCCTAAGTAACCAATTCATCTTATGGGCCGACTGATGAGTTCCACAAATTCCTTCATGAACTTCACCCATAGCAACCTTAGATTGAT[C/T]
ATTGTCTAAGCACTTTAATAATACTCCCTCTATGTTTCAGCGATATAGATCTCCATCAAGCAACATGTATTTGAATGCTTGTCGGCAAATTTTCCGATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 8.40% | 0.08% | 1.21% | NA |
| All Indica | 2759 | 83.80% | 14.00% | 0.14% | 2.03% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.20% | 20.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.00% | 0.65% | NA |
| Indica III | 913 | 78.10% | 18.10% | 0.22% | 3.61% | NA |
| Indica Intermediate | 786 | 85.50% | 11.80% | 0.13% | 2.54% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607310239 | G -> A | LOC_Os06g13280.1 | upstream_gene_variant ; 2692.0bp to feature; MODIFIER | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 57.57 | N | N | N | N |
| vg0607310239 | G -> A | LOC_Os06g13290.1 | upstream_gene_variant ; 1506.0bp to feature; MODIFIER | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 57.57 | N | N | N | N |
| vg0607310239 | G -> A | LOC_Os06g13280-LOC_Os06g13290 | intergenic_region ; MODIFIER | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 57.57 | N | N | N | N |
| vg0607310239 | G -> DEL | N | N | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 57.57 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607310239 | NA | 3.35E-07 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607310239 | NA | 1.11E-08 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607310239 | 1.59E-06 | NA | mr1970_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607310239 | 2.11E-09 | 1.70E-08 | mr1970_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607310239 | 7.40E-10 | NA | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607310239 | 5.47E-16 | 1.45E-15 | mr1973_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |