\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607310239:

Variant ID: vg0607310239 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7310239
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TGATCGGAAAATTTGCCGACAAGCATTCAAATACATGTTGCTTGATGGAGATCTATATCGCTGAAACATAGAGGGAGTATTATTAAAGTGCTTAGACAAT[G/A]
ATCAATCTAAGGTTGCTATGGGTGAAGTTCATGAAGGAATTTGTGGAACTCATCAGTCGGCCCATAAGATGAATTGGTTACTTAGGAGAGCGGGATTCTA

Reverse complement sequence

TAGAATCCCGCTCTCCTAAGTAACCAATTCATCTTATGGGCCGACTGATGAGTTCCACAAATTCCTTCATGAACTTCACCCATAGCAACCTTAGATTGAT[C/T]
ATTGTCTAAGCACTTTAATAATACTCCCTCTATGTTTCAGCGATATAGATCTCCATCAAGCAACATGTATTTGAATGCTTGTCGGCAAATTTTCCGATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 8.40% 0.08% 1.21% NA
All Indica  2759 83.80% 14.00% 0.14% 2.03% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 79.20% 20.70% 0.17% 0.00% NA
Indica II  465 98.10% 1.30% 0.00% 0.65% NA
Indica III  913 78.10% 18.10% 0.22% 3.61% NA
Indica Intermediate  786 85.50% 11.80% 0.13% 2.54% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607310239 G -> A LOC_Os06g13280.1 upstream_gene_variant ; 2692.0bp to feature; MODIFIER silent_mutation Average:45.099; most accessible tissue: Callus, score: 57.57 N N N N
vg0607310239 G -> A LOC_Os06g13290.1 upstream_gene_variant ; 1506.0bp to feature; MODIFIER silent_mutation Average:45.099; most accessible tissue: Callus, score: 57.57 N N N N
vg0607310239 G -> A LOC_Os06g13280-LOC_Os06g13290 intergenic_region ; MODIFIER silent_mutation Average:45.099; most accessible tissue: Callus, score: 57.57 N N N N
vg0607310239 G -> DEL N N silent_mutation Average:45.099; most accessible tissue: Callus, score: 57.57 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607310239 NA 3.35E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239 NA 1.11E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239 1.59E-06 NA mr1970_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239 2.11E-09 1.70E-08 mr1970_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239 7.40E-10 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239 5.47E-16 1.45E-15 mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251