Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0607310239:

Variant ID: vg0607310239 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7310239
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TGATCGGAAAATTTGCCGACAAGCATTCAAATACATGTTGCTTGATGGAGATCTATATCGCTGAAACATAGAGGGAGTATTATTAAAGTGCTTAGACAAT[G/A]
ATCAATCTAAGGTTGCTATGGGTGAAGTTCATGAAGGAATTTGTGGAACTCATCAGTCGGCCCATAAGATGAATTGGTTACTTAGGAGAGCGGGATTCTA

Reverse complement sequence

TAGAATCCCGCTCTCCTAAGTAACCAATTCATCTTATGGGCCGACTGATGAGTTCCACAAATTCCTTCATGAACTTCACCCATAGCAACCTTAGATTGAT[C/T]
ATTGTCTAAGCACTTTAATAATACTCCCTCTATGTTTCAGCGATATAGATCTCCATCAAGCAACATGTATTTGAATGCTTGTCGGCAAATTTTCCGATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	8.40%	0.08%	1.21%	NA
All Indica	2759	83.80%	14.00%	0.14%	2.03%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	79.20%	20.70%	0.17%	0.00%	NA
Indica II	465	98.10%	1.30%	0.00%	0.65%	NA
Indica III	913	78.10%	18.10%	0.22%	3.61%	NA
Indica Intermediate	786	85.50%	11.80%	0.13%	2.54%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607310239	G -> A	LOC_Os06g13280.1	upstream_gene_variant ; 2692.0bp to feature; MODIFIER	silent_mutation	Average:45.099; most accessible tissue: Callus, score: 57.57	N	N	N	N
vg0607310239	G -> A	LOC_Os06g13290.1	upstream_gene_variant ; 1506.0bp to feature; MODIFIER	silent_mutation	Average:45.099; most accessible tissue: Callus, score: 57.57	N	N	N	N
vg0607310239	G -> A	LOC_Os06g13280-LOC_Os06g13290	intergenic_region ; MODIFIER	silent_mutation	Average:45.099; most accessible tissue: Callus, score: 57.57	N	N	N	N
vg0607310239	G -> DEL	N	N	silent_mutation	Average:45.099; most accessible tissue: Callus, score: 57.57	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607310239	NA	3.35E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239	NA	1.11E-08	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239	1.59E-06	NA	mr1970_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239	2.11E-09	1.70E-08	mr1970_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239	7.40E-10	NA	mr1973_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607310239	5.47E-16	1.45E-15	mr1973_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251