\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607252722:

Variant ID: vg0607252722 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7252722
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GATGAGGCAGGTAGCATAGTCACAAAGATGAGAAGTAGGAAGATTAATAGATTGCGAGACGATGATCAATATCTCAAATCTTGAATGGATGTGGGGTGGC[G/A]
CGGTCGTAGATGGGTTCATCCATCCTATTGGTAACCATATGTGGAATCAAGAAATTGTATGAACAGAATACGTAGTGTGAATCAACCGATTTCATCAACA

Reverse complement sequence

TGTTGATGAAATCGGTTGATTCACACTACGTATTCTGTTCATACAATTTCTTGATTCCACATATGGTTACCAATAGGATGGATGAACCCATCTACGACCG[C/T]
GCCACCCCACATCCATTCAAGATTTGAGATATTGATCATCGTCTCGCAATCTATTAATCTTCCTACTTCTCATCTTTGTGACTATGCTACCTGCCTCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.40% 0.08% 0.00% NA
All Indica  2759 91.70% 8.20% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 82.10% 17.50% 0.33% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 67.70% 1.04% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607252722 G -> A LOC_Os06g13215.1 upstream_gene_variant ; 4099.0bp to feature; MODIFIER silent_mutation Average:78.758; most accessible tissue: Callus, score: 93.054 N N N N
vg0607252722 G -> A LOC_Os06g13210.1 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:78.758; most accessible tissue: Callus, score: 93.054 N N N N
vg0607252722 G -> A LOC_Os06g13210.2 downstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:78.758; most accessible tissue: Callus, score: 93.054 N N N N
vg0607252722 G -> A LOC_Os06g13210-LOC_Os06g13215 intergenic_region ; MODIFIER silent_mutation Average:78.758; most accessible tissue: Callus, score: 93.054 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607252722 7.15E-12 NA mr1970 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 7.09E-11 4.79E-18 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 1.80E-13 NA mr1973 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 2.77E-13 1.83E-25 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 NA 2.72E-06 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 2.61E-17 NA mr1970_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 2.15E-17 2.09E-24 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 5.63E-23 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722 4.18E-31 1.23E-37 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251