Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607252722:

Variant ID: vg0607252722 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7252722
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAGGCAGGTAGCATAGTCACAAAGATGAGAAGTAGGAAGATTAATAGATTGCGAGACGATGATCAATATCTCAAATCTTGAATGGATGTGGGGTGGC[G/A]
CGGTCGTAGATGGGTTCATCCATCCTATTGGTAACCATATGTGGAATCAAGAAATTGTATGAACAGAATACGTAGTGTGAATCAACCGATTTCATCAACA

Reverse complement sequence

TGTTGATGAAATCGGTTGATTCACACTACGTATTCTGTTCATACAATTTCTTGATTCCACATATGGTTACCAATAGGATGGATGAACCCATCTACGACCG[C/T]
GCCACCCCACATCCATTCAAGATTTGAGATATTGATCATCGTCTCGCAATCTATTAATCTTCCTACTTCTCATCTTTGTGACTATGCTACCTGCCTCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	6.40%	0.08%	0.00%	NA
All Indica	2759	91.70%	8.20%	0.11%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	82.10%	17.50%	0.33%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	67.70%	1.04%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607252722	G -> A	LOC_Os06g13215.1	upstream_gene_variant ; 4099.0bp to feature; MODIFIER	silent_mutation	Average:78.758; most accessible tissue: Callus, score: 93.054	N	N	N	N
vg0607252722	G -> A	LOC_Os06g13210.1	downstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:78.758; most accessible tissue: Callus, score: 93.054	N	N	N	N
vg0607252722	G -> A	LOC_Os06g13210.2	downstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:78.758; most accessible tissue: Callus, score: 93.054	N	N	N	N
vg0607252722	G -> A	LOC_Os06g13210-LOC_Os06g13215	intergenic_region ; MODIFIER	silent_mutation	Average:78.758; most accessible tissue: Callus, score: 93.054	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607252722	7.15E-12	NA	mr1970	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	7.09E-11	4.79E-18	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	1.80E-13	NA	mr1973	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	2.77E-13	1.83E-25	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	NA	2.72E-06	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	2.61E-17	NA	mr1970_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	2.15E-17	2.09E-24	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	5.63E-23	NA	mr1973_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607252722	4.18E-31	1.23E-37	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251