Variant ID: vg0607252722 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 7252722 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 277. )
GATGAGGCAGGTAGCATAGTCACAAAGATGAGAAGTAGGAAGATTAATAGATTGCGAGACGATGATCAATATCTCAAATCTTGAATGGATGTGGGGTGGC[G/A]
CGGTCGTAGATGGGTTCATCCATCCTATTGGTAACCATATGTGGAATCAAGAAATTGTATGAACAGAATACGTAGTGTGAATCAACCGATTTCATCAACA
TGTTGATGAAATCGGTTGATTCACACTACGTATTCTGTTCATACAATTTCTTGATTCCACATATGGTTACCAATAGGATGGATGAACCCATCTACGACCG[C/T]
GCCACCCCACATCCATTCAAGATTTGAGATATTGATCATCGTCTCGCAATCTATTAATCTTCCTACTTCTCATCTTTGTGACTATGCTACCTGCCTCATC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.50% | 6.40% | 0.08% | 0.00% | NA |
All Indica | 2759 | 91.70% | 8.20% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 82.10% | 17.50% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 31.20% | 67.70% | 1.04% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0607252722 | G -> A | LOC_Os06g13215.1 | upstream_gene_variant ; 4099.0bp to feature; MODIFIER | silent_mutation | Average:78.758; most accessible tissue: Callus, score: 93.054 | N | N | N | N |
vg0607252722 | G -> A | LOC_Os06g13210.1 | downstream_gene_variant ; 1664.0bp to feature; MODIFIER | silent_mutation | Average:78.758; most accessible tissue: Callus, score: 93.054 | N | N | N | N |
vg0607252722 | G -> A | LOC_Os06g13210.2 | downstream_gene_variant ; 1664.0bp to feature; MODIFIER | silent_mutation | Average:78.758; most accessible tissue: Callus, score: 93.054 | N | N | N | N |
vg0607252722 | G -> A | LOC_Os06g13210-LOC_Os06g13215 | intergenic_region ; MODIFIER | silent_mutation | Average:78.758; most accessible tissue: Callus, score: 93.054 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0607252722 | 7.15E-12 | NA | mr1970 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 7.09E-11 | 4.79E-18 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 1.80E-13 | NA | mr1973 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 2.77E-13 | 1.83E-25 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | NA | 2.72E-06 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 2.61E-17 | NA | mr1970_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 2.15E-17 | 2.09E-24 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 5.63E-23 | NA | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0607252722 | 4.18E-31 | 1.23E-37 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |