\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607240987:

Variant ID: vg0607240987 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7240987
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


TATAAGAGCAAGTTTAATGGTATAGCCAACTACTAGCTTCAAATCACTTATAGCCAACTTAATAGCTGATTCATACAATAGCTACCTATAAACATATAAT[A/G]
CACTATTAATACATAGTCCCACCTATCATATATACATTGTGTCTTAAAGTCTGTGCTACAGCTGGCTACAAATCTGTAGCCCCCGCTGCTCTTCTGTCTC

Reverse complement sequence

GAGACAGAAGAGCAGCGGGGGCTACAGATTTGTAGCCAGCTGTAGCACAGACTTTAAGACACAATGTATATATGATAGGTGGGACTATGTATTAATAGTG[T/C]
ATTATATGTTTATAGGTAGCTATTGTATGAATCAGCTATTAAGTTGGCTATAAGTGATTTGAAGCTAGTAGTTGGCTATACCATTAAACTTGCTCTTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 45.50% 1.23% 0.97% NA
All Indica  2759 22.70% 73.70% 1.96% 1.67% NA
All Japonica  1512 98.90% 1.00% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 25.70% 72.60% 1.34% 0.34% NA
Indica II  465 11.20% 82.80% 3.66% 2.37% NA
Indica III  913 25.70% 71.00% 1.64% 1.64% NA
Indica Intermediate  786 23.50% 72.40% 1.78% 2.29% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607240987 A -> G LOC_Os06g13200-LOC_Os06g13210 intergenic_region ; MODIFIER silent_mutation Average:75.566; most accessible tissue: Callus, score: 94.992 N N N N
vg0607240987 A -> DEL N N silent_mutation Average:75.566; most accessible tissue: Callus, score: 94.992 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607240987 A G -0.07 0.0 0.0 -0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607240987 NA 2.01E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 NA 7.15E-10 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 NA 4.05E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 NA 2.70E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 3.61E-08 NA mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 1.55E-06 3.15E-11 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 NA 4.17E-14 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 3.27E-07 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 1.23E-06 9.20E-09 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 7.51E-12 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607240987 1.52E-10 1.76E-15 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251