Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607216580:

Variant ID: vg0607216580 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7216580
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AGGACTTGCTCAGTGAGGAGGATGCAACCGCCAGCGGCAGGGTATGGAGGAGGACCTGCTCAAAGAGGAGGGCTGCCAGCGATGACCTCCGGTGCGAGGC[A/G]
TGGATGATCAAGTACCTTCTTAGCACGAAGGACACGACCGTTGTGATGACCTCCAGTGCAGGGCATGGATGGTAGAGGACCTGCTCCTTGTCAACTACAT

Reverse complement sequence

ATGTAGTTGACAAGGAGCAGGTCCTCTACCATCCATGCCCTGCACTGGAGGTCATCACAACGGTCGTGTCCTTCGTGCTAAGAAGGTACTTGATCATCCA[T/C]
GCCTCGCACCGGAGGTCATCGCTGGCAGCCCTCCTCTTTGAGCAGGTCCTCCTCCATACCCTGCCGCTGGCGGTTGCATCCTCCTCACTGAGCAAGTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 30.70% 0.19% 1.57% NA
All Indica  2759 98.50% 1.30% 0.11% 0.11% NA
All Japonica  1512 10.30% 89.20% 0.26% 0.26% NA
Aus  269 96.70% 3.00% 0.00% 0.37% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 98.40% 1.40% 0.11% 0.11% NA
Indica Intermediate  786 97.50% 2.40% 0.00% 0.13% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 25.80% 73.40% 0.79% 0.00% NA
Japonica Intermediate  241 6.20% 92.10% 0.00% 1.66% NA
VI/Aromatic  96 8.30% 25.00% 1.04% 65.62% NA
Intermediate  90 57.80% 37.80% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607216580 A -> G LOC_Os06g13140.1 upstream_gene_variant ; 4090.0bp to feature; MODIFIER silent_mutation Average:71.689; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0607216580 A -> G LOC_Os06g13160.1 downstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:71.689; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0607216580 A -> G LOC_Os06g13150.1 intron_variant ; MODIFIER silent_mutation Average:71.689; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0607216580 A -> DEL N N silent_mutation Average:71.689; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607216580 NA 2.18E-59 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0607216580 NA 5.37E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 2.93E-46 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.30E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 8.45E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 2.77E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 9.15E-06 1.32E-29 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 2.86E-30 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 3.49E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.32E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 3.19E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.39E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 8.49E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.14E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.21E-12 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 6.48E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 5.43E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.31E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 4.95E-80 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 3.36E-64 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 4.70E-54 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.86E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.78E-30 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.67E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.59E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 6.11E-08 6.10E-08 mr1333_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 4.34E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.09E-27 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 3.40E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.11E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 3.15E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.24E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 4.64E-36 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 1.41E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607216580 NA 7.98E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251