\
| Variant ID: vg0607168309 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7168309 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCAAAGGAAATTTTTCAAGAGGTTGGAGCTCTTGCTAAATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGGAATTTCATAGGATTTGGAAAG[C/T]
TTCAATCCTTTGAATCAAAGGGCCAAATAGGAAAATTTACTATAGGATTTGAATCCTATGAAATTTCTACATAAATCTTTTGATTCAAAAGGGCCCTAAT
ATTAGGGCCCTTTTGAATCAAAAGATTTATGTAGAAATTTCATAGGATTCAAATCCTATAGTAAATTTTCCTATTTGGCCCTTTGATTCAAAGGATTGAA[G/A]
CTTTCCAAATCCTATGAAATTCCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAATTTAGCAAGAGCTCCAACCTCTTGAAAAATTTCCTTTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 9.80% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 83.10% | 16.60% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.60% | 33.80% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 83.30% | 16.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607168309 | C -> T | LOC_Os06g13060.1 | upstream_gene_variant ; 4153.0bp to feature; MODIFIER | silent_mutation | Average:28.068; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0607168309 | C -> T | LOC_Os06g13070.1 | downstream_gene_variant ; 1521.0bp to feature; MODIFIER | silent_mutation | Average:28.068; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0607168309 | C -> T | LOC_Os06g13060-LOC_Os06g13070 | intergenic_region ; MODIFIER | silent_mutation | Average:28.068; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607168309 | NA | 3.91E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607168309 | 1.29E-06 | 1.29E-06 | mr1996 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607168309 | NA | 5.44E-08 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607168309 | NA | 3.02E-09 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607168309 | 3.17E-08 | 2.55E-07 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |