\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607168309:

Variant ID: vg0607168309 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7168309
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAAAGGAAATTTTTCAAGAGGTTGGAGCTCTTGCTAAATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGGAATTTCATAGGATTTGGAAAG[C/T]
TTCAATCCTTTGAATCAAAGGGCCAAATAGGAAAATTTACTATAGGATTTGAATCCTATGAAATTTCTACATAAATCTTTTGATTCAAAAGGGCCCTAAT

Reverse complement sequence

ATTAGGGCCCTTTTGAATCAAAAGATTTATGTAGAAATTTCATAGGATTCAAATCCTATAGTAAATTTTCCTATTTGGCCCTTTGATTCAAAGGATTGAA[G/A]
CTTTCCAAATCCTATGAAATTCCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAATTTAGCAAGAGCTCCAACCTCTTGAAAAATTTCCTTTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.80% 0.15% 0.00% NA
All Indica  2759 83.10% 16.60% 0.25% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.80% 3.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 65.60% 33.80% 0.55% 0.00% NA
Indica Intermediate  786 83.30% 16.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607168309 C -> T LOC_Os06g13060.1 upstream_gene_variant ; 4153.0bp to feature; MODIFIER silent_mutation Average:28.068; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0607168309 C -> T LOC_Os06g13070.1 downstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:28.068; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0607168309 C -> T LOC_Os06g13060-LOC_Os06g13070 intergenic_region ; MODIFIER silent_mutation Average:28.068; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607168309 NA 3.91E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607168309 1.29E-06 1.29E-06 mr1996 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607168309 NA 5.44E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607168309 NA 3.02E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607168309 3.17E-08 2.55E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251