\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607160298:

Variant ID: vg0607160298 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7160298
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:


TATACGATGAAAAGAATCATAATTGGACAATGGTGGCTGCACATATGACAAGCTATGGATGCTTCTATCTCACGATCACATCACGAGCTCGGTCTCTTAA[T/C]
TATTTTGATACAGTTCGATGAGTGGCCACTGACCAAAAGGAGCTTCAAGGGGATCGAAAAAAATATTTCTCCAACCATCTCAGGCCTGCACCCAATCTTT

Reverse complement sequence

AAAGATTGGGTGCAGGCCTGAGATGGTTGGAGAAATATTTTTTTCGATCCCCTTGAAGCTCCTTTTGGTCAGTGGCCACTCATCGAACTGTATCAAAATA[A/G]
TTAAGAGACCGAGCTCGTGATGTGATCGTGAGATAGAAGCATCCATAGCTTGTCATATGTGCAGCCACCATTGTCCAATTATGATTCTTTTCATCGTATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 41.00% 0.25% 0.17% NA
All Indica  2759 33.20% 66.10% 0.40% 0.29% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 34.10% 65.70% 0.00% 0.17% NA
Indica II  465 8.00% 91.40% 0.43% 0.22% NA
Indica III  913 48.20% 50.80% 0.44% 0.55% NA
Indica Intermediate  786 30.20% 69.10% 0.64% 0.13% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607160298 T -> C LOC_Os06g13060.1 3_prime_UTR_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.895; most accessible tissue: Zhenshan97 flower, score: 86.56 N N N N
vg0607160298 T -> C LOC_Os06g13050.1 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:64.895; most accessible tissue: Zhenshan97 flower, score: 86.56 N N N N
vg0607160298 T -> DEL N N silent_mutation Average:64.895; most accessible tissue: Zhenshan97 flower, score: 86.56 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607160298 NA 6.23E-14 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 4.49E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 9.78E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 1.03E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 2.85E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 4.37E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 3.44E-07 mr1989 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 NA 3.54E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298 3.38E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251