Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607160298:

Variant ID: vg0607160298 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7160298
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:

TATACGATGAAAAGAATCATAATTGGACAATGGTGGCTGCACATATGACAAGCTATGGATGCTTCTATCTCACGATCACATCACGAGCTCGGTCTCTTAA[T/C]
TATTTTGATACAGTTCGATGAGTGGCCACTGACCAAAAGGAGCTTCAAGGGGATCGAAAAAAATATTTCTCCAACCATCTCAGGCCTGCACCCAATCTTT

Reverse complement sequence

AAAGATTGGGTGCAGGCCTGAGATGGTTGGAGAAATATTTTTTTCGATCCCCTTGAAGCTCCTTTTGGTCAGTGGCCACTCATCGAACTGTATCAAAATA[A/G]
TTAAGAGACCGAGCTCGTGATGTGATCGTGAGATAGAAGCATCCATAGCTTGTCATATGTGCAGCCACCATTGTCCAATTATGATTCTTTTCATCGTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	41.00%	0.25%	0.17%	NA
All Indica	2759	33.20%	66.10%	0.40%	0.29%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	34.10%	65.70%	0.00%	0.17%	NA
Indica II	465	8.00%	91.40%	0.43%	0.22%	NA
Indica III	913	48.20%	50.80%	0.44%	0.55%	NA
Indica Intermediate	786	30.20%	69.10%	0.64%	0.13%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607160298	T -> C	LOC_Os06g13060.1	3_prime_UTR_variant ; 280.0bp to feature; MODIFIER	silent_mutation	Average:64.895; most accessible tissue: Zhenshan97 flower, score: 86.56	N	N	N	N
vg0607160298	T -> C	LOC_Os06g13050.1	upstream_gene_variant ; 1476.0bp to feature; MODIFIER	silent_mutation	Average:64.895; most accessible tissue: Zhenshan97 flower, score: 86.56	N	N	N	N
vg0607160298	T -> DEL	N	N	silent_mutation	Average:64.895; most accessible tissue: Zhenshan97 flower, score: 86.56	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607160298	NA	6.23E-14	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	4.49E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	9.78E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	1.03E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	2.85E-11	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	4.37E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	3.44E-07	mr1989	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	NA	3.54E-15	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607160298	3.38E-06	NA	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251