\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607159174:

Variant ID: vg0607159174 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7159174
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCTGTACGACATTGATCGAAAATCGTCGATTTTTATTGGTTCTTCGTTGTTGATGAGGAGCGGTTTTTACTTCGAAAATGAAAAGGGGATTTTATTGT[C/T]
CAATGGAAATATGGAATAATTTGAAATTATCTTATACTCCCTCCGTCCCATAATAGCTTACGTTTTTGACTTTTTATTTGCAACGTTTGACCATTCGTTT

Reverse complement sequence

AAACGAATGGTCAAACGTTGCAAATAAAAAGTCAAAAACGTAAGCTATTATGGGACGGAGGGAGTATAAGATAATTTCAAATTATTCCATATTTCCATTG[G/A]
ACAATAAAATCCCCTTTTCATTTTCGAAGTAAAAACCGCTCCTCATCAACAACGAAGAACCAATAAAAATCGACGATTTTCGATCAATGTCGTACAGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.60% 0.19% 0.02% NA
All Indica  2759 34.30% 65.50% 0.25% 0.04% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 34.60% 65.40% 0.00% 0.00% NA
Indica II  465 9.00% 90.50% 0.22% 0.22% NA
Indica III  913 49.50% 50.30% 0.22% 0.00% NA
Indica Intermediate  786 31.20% 68.30% 0.51% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607159174 C -> T LOC_Os06g13050.1 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0607159174 C -> T LOC_Os06g13060.1 downstream_gene_variant ; 814.0bp to feature; MODIFIER silent_mutation Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0607159174 C -> T LOC_Os06g13050-LOC_Os06g13060 intergenic_region ; MODIFIER silent_mutation Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0607159174 C -> DEL N N silent_mutation Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607159174 NA 2.38E-14 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 1.19E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 9.07E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 2.47E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 3.83E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 2.68E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 1.12E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 5.47E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 4.60E-07 mr1989 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 1.34E-16 mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 1.24E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 1.96E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 6.52E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 3.08E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174 NA 8.55E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251