Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607159174:

Variant ID: vg0607159174 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7159174
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCTGTACGACATTGATCGAAAATCGTCGATTTTTATTGGTTCTTCGTTGTTGATGAGGAGCGGTTTTTACTTCGAAAATGAAAAGGGGATTTTATTGT[C/T]
CAATGGAAATATGGAATAATTTGAAATTATCTTATACTCCCTCCGTCCCATAATAGCTTACGTTTTTGACTTTTTATTTGCAACGTTTGACCATTCGTTT

Reverse complement sequence

AAACGAATGGTCAAACGTTGCAAATAAAAAGTCAAAAACGTAAGCTATTATGGGACGGAGGGAGTATAAGATAATTTCAAATTATTCCATATTTCCATTG[G/A]
ACAATAAAATCCCCTTTTCATTTTCGAAGTAAAAACCGCTCCTCATCAACAACGAAGAACCAATAAAAATCGACGATTTTCGATCAATGTCGTACAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	40.60%	0.19%	0.02%	NA
All Indica	2759	34.30%	65.50%	0.25%	0.04%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	34.60%	65.40%	0.00%	0.00%	NA
Indica II	465	9.00%	90.50%	0.22%	0.22%	NA
Indica III	913	49.50%	50.30%	0.22%	0.00%	NA
Indica Intermediate	786	31.20%	68.30%	0.51%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	66.70%	31.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607159174	C -> T	LOC_Os06g13050.1	upstream_gene_variant ; 352.0bp to feature; MODIFIER	silent_mutation	Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg0607159174	C -> T	LOC_Os06g13060.1	downstream_gene_variant ; 814.0bp to feature; MODIFIER	silent_mutation	Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg0607159174	C -> T	LOC_Os06g13050-LOC_Os06g13060	intergenic_region ; MODIFIER	silent_mutation	Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg0607159174	C -> DEL	N	N	silent_mutation	Average:46.822; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607159174	NA	2.38E-14	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	1.19E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	9.07E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	2.47E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	3.83E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	2.68E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	1.12E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	5.47E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	4.60E-07	mr1989	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	1.34E-16	mr1138_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	1.24E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	1.96E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	6.52E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	3.08E-06	NA	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607159174	NA	8.55E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251