Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0607145417:

Variant ID: vg0607145417 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7145417
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTCGCCGTGGCCGCCGACGAAGACGTTGGTTTGAAGGGTGATGGGGTTGCCATCCTTGTCGCCAAGGAACTCGAAGTCCACCTCGTCCTGCACGTCCC[A/T]
GTCTGGCTCTGACGCCAGCTACCCGTGCAATTTCAGAAATAAATTAAATTAATTGTTACATTCAGTTAATTACTGGTGCTTAGTTTTTAGTCAATATTAA

Reverse complement sequence

TTAATATTGACTAAAAACTAAGCACCAGTAATTAACTGAATGTAACAATTAATTTAATTTATTTCTGAAATTGCACGGGTAGCTGGCGTCAGAGCCAGAC[T/A]
GGGACGTGCAGGACGAGGTGGACTTCGAGTTCCTTGGCGACAAGGATGGCAACCCCATCACCCTTCAAACCAACGTCTTCGTCGGCGGCCACGGCGACCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.90% 0.04% 0.00% NA
All Indica  2759 93.70% 6.30% 0.07% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 95.50% 4.30% 0.22% 0.00% NA
Indica III  913 88.00% 12.00% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607145417 A -> T LOC_Os06g13040.1 missense_variant ; p.Trp113Arg; MODERATE nonsynonymous_codon ; W113R Average:85.504; most accessible tissue: Zhenshan97 flag leaf, score: 96.514 probably damaging -2.366 TOLERATED 0.21

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607145417 A T 0.21 0.14 0.08 0.03 0.1 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607145417 NA 1.12E-46 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.99E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 3.73E-31 mr1298 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 7.30E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.45E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.62E-42 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 7.09E-20 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.50E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.38E-53 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.73E-60 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 6.05E-27 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 8.29E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 3.86E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.99E-37 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.38E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.79E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 3.33E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 7.80E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.15E-53 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.03E-36 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.48E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 1.95E-62 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 3.06E-50 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 2.75E-45 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 NA 5.85E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607145417 1.36E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251