Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607075796:

Variant ID: vg0607075796 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7075796
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAGAATGAATGAGGATGGTTTTGGATGGGGAGCTGGTGTGCTTAGTAGGGCCAAGCAAGCTGGTGTGCTTAGTAGGGCCAAGCAAGGCAGCCCCCGAT[C/T]
TGAATAGGGGTGTGCGTACCCACTCATTAGTATTCCTTTTGCTCCCTCCGCCGCGGCACCGCCATGGTTGAGGTTTGCCCTATTGAACCTAGGGTGTGTT

Reverse complement sequence

AACACACCCTAGGTTCAATAGGGCAAACCTCAACCATGGCGGTGCCGCGGCGGAGGGAGCAAAAGGAATACTAATGAGTGGGTACGCACACCCCTATTCA[G/A]
ATCGGGGGCTGCCTTGCTTGGCCCTACTAAGCACACCAGCTTGCTTGGCCCTACTAAGCACACCAGCTCCCCATCCAAAACCATCCTCATTCATTCTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	1.10%	1.46%	21.14%	NA
All Indica	2759	66.80%	0.00%	0.80%	32.40%	NA
All Japonica	1512	93.50%	3.20%	2.51%	0.73%	NA
Aus	269	94.80%	0.00%	0.00%	5.20%	NA
Indica I	595	71.30%	0.00%	0.67%	28.07%	NA
Indica II	465	69.50%	0.00%	0.65%	29.89%	NA
Indica III	913	64.40%	0.10%	0.77%	34.72%	NA
Indica Intermediate	786	64.50%	0.00%	1.02%	34.48%	NA
Temperate Japonica	767	88.10%	6.40%	4.82%	0.65%	NA
Tropical Japonica	504	99.40%	0.00%	0.20%	0.40%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	26.00%	0.00%	6.25%	67.71%	NA
Intermediate	90	80.00%	0.00%	3.33%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607075796	C -> T	LOC_Os06g12920.1	downstream_gene_variant ; 2605.0bp to feature; MODIFIER	silent_mutation	Average:34.974; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0607075796	C -> T	LOC_Os06g12930.1	downstream_gene_variant ; 986.0bp to feature; MODIFIER	silent_mutation	Average:34.974; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0607075796	C -> T	LOC_Os06g12940.1	downstream_gene_variant ; 3881.0bp to feature; MODIFIER	silent_mutation	Average:34.974; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0607075796	C -> T	LOC_Os06g12920-LOC_Os06g12930	intergenic_region ; MODIFIER	silent_mutation	Average:34.974; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0607075796	C -> DEL	N	N	silent_mutation	Average:34.974; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607075796	NA	1.04E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	NA	5.13E-06	mr1245	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	2.73E-07	2.73E-07	mr1369	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	7.96E-06	7.96E-06	mr1373	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	NA	1.45E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	NA	1.22E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	NA	1.91E-07	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	NA	2.53E-07	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607075796	NA	6.58E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251