\
| Variant ID: vg0607025048 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 7025048 |
| Reference Allele: T | Alternative Allele: A,TA,TTAA |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, A: 0.13, others allele: 0.00, population size: 97. )
ATTTAACGGTTCTAAGGGTGCTTCGTTTGTAGGGGTTCCCAACTCTTATTTCTCCTTTTCCGCGCGCACGTTTTTCAAATTACTAAACGGTGTGTTTTTT[T/A,TA,TTAA]
AAAAAATATATATATAGAAAAGTTGTTTTAAAAATTATATTAATCCATTTCTCAAGTTAGTTTTAGTTAATACTCCCTCCGTATTTTAATGTATGACGCC
GGCGTCATACATTAAAATACGGAGGGAGTATTAACTAAAACTAACTTGAGAAATGGATTAATATAATTTTTAAAACAACTTTTCTATATATATATTTTTT[A/T,TA,TTAA]
AAAAAACACACCGTTTAGTAATTTGAAAAACGTGCGCGCGGAAAAGGAGAAATAAGAGTTGGGAACCCCTACAAACGAAGCACCCTTAGAACCGTTAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 32.10% | 1.02% | 1.02% | TA: 0.08%; TTAA: 0.02% |
| All Indica | 2759 | 66.10% | 30.60% | 1.38% | 1.74% | TA: 0.07%; TTAA: 0.04% |
| All Japonica | 1512 | 78.90% | 20.50% | 0.46% | 0.00% | TA: 0.13% |
| Aus | 269 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.90% | 31.30% | 3.03% | 1.68% | TA: 0.17% |
| Indica II | 465 | 89.00% | 4.30% | 1.94% | 4.73% | NA |
| Indica III | 913 | 54.40% | 44.50% | 0.22% | 0.77% | TA: 0.11% |
| Indica Intermediate | 786 | 67.90% | 29.60% | 1.15% | 1.15% | TTAA: 0.13% |
| Temperate Japonica | 767 | 99.30% | 0.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 57.10% | 0.00% | 0.00% | TA: 0.40% |
| Japonica Intermediate | 241 | 90.00% | 8.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 27.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607025048 | T -> DEL | N | N | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> A | LOC_Os06g12830.1 | upstream_gene_variant ; 2987.0bp to feature; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> A | LOC_Os06g12840.1 | downstream_gene_variant ; 555.0bp to feature; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> A | LOC_Os06g12830-LOC_Os06g12840 | intergenic_region ; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> TTAA | LOC_Os06g12830.1 | upstream_gene_variant ; 2988.0bp to feature; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> TTAA | LOC_Os06g12840.1 | downstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> TTAA | LOC_Os06g12830-LOC_Os06g12840 | intergenic_region ; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> TA | LOC_Os06g12830.1 | upstream_gene_variant ; 2988.0bp to feature; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> TA | LOC_Os06g12840.1 | downstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0607025048 | T -> TA | LOC_Os06g12830-LOC_Os06g12840 | intergenic_region ; MODIFIER | silent_mutation | Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607025048 | NA | 2.29E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 1.83E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 8.17E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 2.13E-08 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 2.07E-09 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 1.53E-10 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 8.34E-10 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 2.06E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 1.28E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 1.41E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | NA | 6.14E-11 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | 6.30E-06 | NA | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607025048 | 1.16E-07 | 5.37E-14 | mr1973_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |