\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607025048:

Variant ID: vg0607025048 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 7025048
Reference Allele: TAlternative Allele: A,TA,TTAA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, A: 0.13, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAACGGTTCTAAGGGTGCTTCGTTTGTAGGGGTTCCCAACTCTTATTTCTCCTTTTCCGCGCGCACGTTTTTCAAATTACTAAACGGTGTGTTTTTT[T/A,TA,TTAA]
AAAAAATATATATATAGAAAAGTTGTTTTAAAAATTATATTAATCCATTTCTCAAGTTAGTTTTAGTTAATACTCCCTCCGTATTTTAATGTATGACGCC

Reverse complement sequence

GGCGTCATACATTAAAATACGGAGGGAGTATTAACTAAAACTAACTTGAGAAATGGATTAATATAATTTTTAAAACAACTTTTCTATATATATATTTTTT[A/T,TA,TTAA]
AAAAAACACACCGTTTAGTAATTTGAAAAACGTGCGCGCGGAAAAGGAGAAATAAGAGTTGGGAACCCCTACAAACGAAGCACCCTTAGAACCGTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 32.10% 1.02% 1.02% TA: 0.08%; TTAA: 0.02%
All Indica  2759 66.10% 30.60% 1.38% 1.74% TA: 0.07%; TTAA: 0.04%
All Japonica  1512 78.90% 20.50% 0.46% 0.00% TA: 0.13%
Aus  269 5.90% 94.10% 0.00% 0.00% NA
Indica I  595 63.90% 31.30% 3.03% 1.68% TA: 0.17%
Indica II  465 89.00% 4.30% 1.94% 4.73% NA
Indica III  913 54.40% 44.50% 0.22% 0.77% TA: 0.11%
Indica Intermediate  786 67.90% 29.60% 1.15% 1.15% TTAA: 0.13%
Temperate Japonica  767 99.30% 0.30% 0.39% 0.00% NA
Tropical Japonica  504 42.50% 57.10% 0.00% 0.00% TA: 0.40%
Japonica Intermediate  241 90.00% 8.30% 1.66% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607025048 T -> DEL N N silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> A LOC_Os06g12830.1 upstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> A LOC_Os06g12840.1 downstream_gene_variant ; 555.0bp to feature; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> A LOC_Os06g12830-LOC_Os06g12840 intergenic_region ; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> TTAA LOC_Os06g12830.1 upstream_gene_variant ; 2988.0bp to feature; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> TTAA LOC_Os06g12840.1 downstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> TTAA LOC_Os06g12830-LOC_Os06g12840 intergenic_region ; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> TA LOC_Os06g12830.1 upstream_gene_variant ; 2988.0bp to feature; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> TA LOC_Os06g12840.1 downstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0607025048 T -> TA LOC_Os06g12830-LOC_Os06g12840 intergenic_region ; MODIFIER silent_mutation Average:40.126; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607025048 NA 2.29E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 1.83E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 8.17E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 2.13E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 2.07E-09 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 1.53E-10 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 8.34E-10 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 2.06E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 1.28E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 1.41E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 NA 6.14E-11 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 6.30E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607025048 1.16E-07 5.37E-14 mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251