\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607019063:

Variant ID: vg0607019063 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7019063
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTCAGTGTCGTAGGCTCATAATAGAGAGTGTAGATGGAGAGGCTGTTGAAGTGAGGAATGAGTTTGGCTTGCCAAATCAATTGGAGAGCTGACTATAT[G/A,T]
GGTGTTTGGAGAGTGTGATTTGAAGAAGCTGTTGGAGATACTCTTAGGGATGCGAAGTAGCCGTATTGCATCCTCGTTGCACGAGATTAAGCGGTCTCAC

Reverse complement sequence

GTGAGACCGCTTAATCTCGTGCAACGAGGATGCAATACGGCTACTTCGCATCCCTAAGAGTATCTCCAACAGCTTCTTCAAATCACACTCTCCAAACACC[C/T,A]
ATATAGTCAGCTCTCCAATTGATTTGGCAAGCCAAACTCATTCCTCACTTCAACAGCCTCTCCATCTACACTCTCTATTATGAGCCTACGACACTGAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 14.20% 0.06% 0.00% T: 0.02%
All Indica  2759 87.10% 12.80% 0.07% 0.00% NA
All Japonica  1512 80.20% 19.80% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% T: 0.37%
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 70.50% 29.40% 0.11% 0.00% NA
Indica Intermediate  786 92.90% 7.00% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 43.10% 56.90% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607019063 G -> T LOC_Os06g12830.1 downstream_gene_variant ; 756.0bp to feature; MODIFIER silent_mutation Average:94.124; most accessible tissue: Minghui63 young leaf, score: 97.07 N N N N
vg0607019063 G -> T LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:94.124; most accessible tissue: Minghui63 young leaf, score: 97.07 N N N N
vg0607019063 G -> A LOC_Os06g12830.1 downstream_gene_variant ; 756.0bp to feature; MODIFIER silent_mutation Average:94.124; most accessible tissue: Minghui63 young leaf, score: 97.07 N N N N
vg0607019063 G -> A LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:94.124; most accessible tissue: Minghui63 young leaf, score: 97.07 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607019063 G A 0.0 -0.02 -0.02 -0.01 -0.02 -0.03
vg0607019063 G T -0.07 -0.03 -0.02 -0.03 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607019063 NA 1.24E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 6.06E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 8.62E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 3.23E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 2.29E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 5.13E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 8.17E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 2.13E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 6.25E-08 1.16E-16 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 5.77E-10 6.55E-25 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 5.00E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 2.06E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 3.90E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 8.69E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 3.21E-09 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 1.28E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 1.41E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 7.93E-06 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 3.65E-13 7.07E-24 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 8.64E-09 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 7.96E-23 3.20E-36 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607019063 NA 4.50E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251