\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607008709:

Variant ID: vg0607008709 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 7008709
Reference Allele: CCAAAlternative Allele: TCAA,CA,CACAA,C,CAAACAA
Primary Allele: CCAASecondary Allele: TCAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTAGCTCACTCGACTCACCGTACGTGTGGACGATGACGACGATAAAATGCCGGCAGCCACAGCCAGCTTTTTGAAGGATTTGTGCGTGCGTCCTTCCGT[CCAA/TCAA,CA,CACAA,C,CAAACAA]
AAAAAAAAAAAGACAAATCCTAAGTTTCCGTGTTCAACTTTGACTGTCCGTTTTATATGAAATTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGAT

Reverse complement sequence

ATCATCTAACAACAATAAAAATACGAATTATAAAAAAATTTCATATAAAACGGACAGTCAAAGTTGAACACGGAAACTTAGGATTTGTCTTTTTTTTTTT[TTGG/TTGA,TG,TTGTG,G,TTGTTTG]
ACGGAAGGACGCACGCACAAATCCTTCAAAAAGCTGGCTGTGGCTGCCGGCATTTTATCGTCGTCATCGTCCACACGTACGGTGAGTCGAGTGAGCTAGC

Allele Frequencies:

Populations Population SizeFrequency of CCAA(primary allele) Frequency of TCAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 32.10% 8.42% 10.75% CA: 0.49%; CACAA: 0.04%; C: 0.02%; CAAACAA: 0.02%
All Indica  2759 30.40% 40.70% 10.84% 17.94% CA: 0.14%; CAAACAA: 0.04%
All Japonica  1512 90.90% 1.10% 5.95% 0.60% CA: 1.26%; CACAA: 0.13%; C: 0.07%
Aus  269 0.40% 99.30% 0.37% 0.00% NA
Indica I  595 26.60% 47.20% 17.31% 8.91% NA
Indica II  465 46.00% 33.80% 12.47% 6.88% CA: 0.86%
Indica III  913 19.80% 38.90% 5.70% 35.49% CAAACAA: 0.11%
Indica Intermediate  786 36.30% 41.90% 10.94% 10.94% NA
Temperate Japonica  767 92.60% 0.80% 6.26% 0.39% NA
Tropical Japonica  504 88.90% 0.80% 4.96% 0.99% CA: 3.77%; CACAA: 0.40%; C: 0.20%
Japonica Intermediate  241 89.60% 2.90% 7.05% 0.41% NA
VI/Aromatic  96 10.40% 88.50% 1.04% 0.00% NA
Intermediate  90 57.80% 30.00% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607008709 CCAA -> CA LOC_Os06g12810.1 upstream_gene_variant ; 4306.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CA LOC_Os06g12820.1 upstream_gene_variant ; 58.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CA LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> TCAA LOC_Os06g12810.1 upstream_gene_variant ; 4305.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> TCAA LOC_Os06g12820.1 upstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> TCAA LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CACAA LOC_Os06g12810.1 upstream_gene_variant ; 4306.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CACAA LOC_Os06g12820.1 upstream_gene_variant ; 58.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CACAA LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> DEL N N silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CAAACAA LOC_Os06g12810.1 upstream_gene_variant ; 4306.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CAAACAA LOC_Os06g12820.1 upstream_gene_variant ; 58.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> CAAACAA LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> C LOC_Os06g12810.1 upstream_gene_variant ; 4306.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> C LOC_Os06g12820.1 upstream_gene_variant ; 58.0bp to feature; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N
vg0607008709 CCAA -> C LOC_Os06g12820-LOC_Os06g12830 intergenic_region ; MODIFIER silent_mutation Average:62.632; most accessible tissue: Callus, score: 82.018 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607008709 NA 7.18E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607008709 NA 3.65E-09 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607008709 NA 1.25E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607008709 2.52E-07 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607008709 NA 5.22E-12 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607008709 8.48E-10 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607008709 1.36E-07 6.29E-12 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251