\
| Variant ID: vg0607008709 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 7008709 |
| Reference Allele: CCAA | Alternative Allele: TCAA,CA,CACAA,C,CAAACAA |
| Primary Allele: CCAA | Secondary Allele: TCAA |
Inferred Ancestral Allele: Not determined.
GCTAGCTCACTCGACTCACCGTACGTGTGGACGATGACGACGATAAAATGCCGGCAGCCACAGCCAGCTTTTTGAAGGATTTGTGCGTGCGTCCTTCCGT[CCAA/TCAA,CA,CACAA,C,CAAACAA]
AAAAAAAAAAAGACAAATCCTAAGTTTCCGTGTTCAACTTTGACTGTCCGTTTTATATGAAATTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGAT
ATCATCTAACAACAATAAAAATACGAATTATAAAAAAATTTCATATAAAACGGACAGTCAAAGTTGAACACGGAAACTTAGGATTTGTCTTTTTTTTTTT[TTGG/TTGA,TG,TTGTG,G,TTGTTTG]
ACGGAAGGACGCACGCACAAATCCTTCAAAAAGCTGGCTGTGGCTGCCGGCATTTTATCGTCGTCATCGTCCACACGTACGGTGAGTCGAGTGAGCTAGC
| Populations | Population Size | Frequency of CCAA(primary allele) | Frequency of TCAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.10% | 32.10% | 8.42% | 10.75% | CA: 0.49%; CACAA: 0.04%; C: 0.02%; CAAACAA: 0.02% |
| All Indica | 2759 | 30.40% | 40.70% | 10.84% | 17.94% | CA: 0.14%; CAAACAA: 0.04% |
| All Japonica | 1512 | 90.90% | 1.10% | 5.95% | 0.60% | CA: 1.26%; CACAA: 0.13%; C: 0.07% |
| Aus | 269 | 0.40% | 99.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 26.60% | 47.20% | 17.31% | 8.91% | NA |
| Indica II | 465 | 46.00% | 33.80% | 12.47% | 6.88% | CA: 0.86% |
| Indica III | 913 | 19.80% | 38.90% | 5.70% | 35.49% | CAAACAA: 0.11% |
| Indica Intermediate | 786 | 36.30% | 41.90% | 10.94% | 10.94% | NA |
| Temperate Japonica | 767 | 92.60% | 0.80% | 6.26% | 0.39% | NA |
| Tropical Japonica | 504 | 88.90% | 0.80% | 4.96% | 0.99% | CA: 3.77%; CACAA: 0.40%; C: 0.20% |
| Japonica Intermediate | 241 | 89.60% | 2.90% | 7.05% | 0.41% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 30.00% | 7.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607008709 | CCAA -> CA | LOC_Os06g12810.1 | upstream_gene_variant ; 4306.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CA | LOC_Os06g12820.1 | upstream_gene_variant ; 58.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CA | LOC_Os06g12820-LOC_Os06g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> TCAA | LOC_Os06g12810.1 | upstream_gene_variant ; 4305.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> TCAA | LOC_Os06g12820.1 | upstream_gene_variant ; 57.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> TCAA | LOC_Os06g12820-LOC_Os06g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CACAA | LOC_Os06g12810.1 | upstream_gene_variant ; 4306.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CACAA | LOC_Os06g12820.1 | upstream_gene_variant ; 58.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CACAA | LOC_Os06g12820-LOC_Os06g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> DEL | N | N | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CAAACAA | LOC_Os06g12810.1 | upstream_gene_variant ; 4306.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CAAACAA | LOC_Os06g12820.1 | upstream_gene_variant ; 58.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> CAAACAA | LOC_Os06g12820-LOC_Os06g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> C | LOC_Os06g12810.1 | upstream_gene_variant ; 4306.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> C | LOC_Os06g12820.1 | upstream_gene_variant ; 58.0bp to feature; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| vg0607008709 | CCAA -> C | LOC_Os06g12820-LOC_Os06g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:62.632; most accessible tissue: Callus, score: 82.018 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607008709 | NA | 7.18E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607008709 | NA | 3.65E-09 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607008709 | NA | 1.25E-08 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607008709 | 2.52E-07 | NA | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607008709 | NA | 5.22E-12 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607008709 | 8.48E-10 | NA | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607008709 | 1.36E-07 | 6.29E-12 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |