\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606988364:

Variant ID: vg0606988364 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6988364
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GTAATTATCATTTTTTATTCGATTTATCGTCAAATGTTTTAAAGCATGACTTAATTTTTTTTATATTTGCACAAAAATTGAATGGTCGAATATAAATTTC[G/A]
GGTATTCCGAGGAATACCTAGGAACCCATGTGTTCGCCAGAATCCTCATATTTGATTCTAATCCCTTTAGGGGAGATATCCTCTCGTGTACCCTTTTCCT

Reverse complement sequence

AGGAAAAGGGTACACGAGAGGATATCTCCCCTAAAGGGATTAGAATCAAATATGAGGATTCTGGCGAACACATGGGTTCCTAGGTATTCCTCGGAATACC[C/T]
GAAATTTATATTCGACCATTCAATTTTTGTGCAAATATAAAAAAAATTAAGTCATGCTTTAAAACATTTGACGATAAATCGAATAAAAAATGATAATTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 13.10% 0.08% 0.00% NA
All Indica  2759 78.20% 21.70% 0.07% 0.00% NA
All Japonica  1512 99.30% 0.60% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 66.70% 33.30% 0.00% 0.00% NA
Indica III  913 72.60% 27.30% 0.11% 0.00% NA
Indica Intermediate  786 76.80% 23.00% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606988364 G -> A LOC_Os06g12790.1 upstream_gene_variant ; 2575.0bp to feature; MODIFIER silent_mutation Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0606988364 G -> A LOC_Os06g12790.3 upstream_gene_variant ; 2575.0bp to feature; MODIFIER silent_mutation Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0606988364 G -> A LOC_Os06g12780.1 downstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0606988364 G -> A LOC_Os06g12780-LOC_Os06g12790 intergenic_region ; MODIFIER silent_mutation Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606988364 1.18E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 3.60E-07 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 2.58E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 2.17E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 3.82E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 9.96E-08 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 5.04E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 6.34E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 6.40E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 9.57E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 2.69E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 8.06E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 8.94E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 8.16E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 1.74E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 6.31E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 2.63E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 1.28E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 8.91E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 5.87E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 1.32E-09 NA mr1970 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 8.84E-07 1.88E-11 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 9.63E-08 NA mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 4.57E-10 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 2.11E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 6.18E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 7.55E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 2.10E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606988364 NA 1.14E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251