Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0606974869:

Variant ID: vg0606974869 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6974869
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAGGAGTTTTCAGTGAATGAGTGAATGTTCTAGCTGTGTTTAGTTCACGTCAAAATTGGAAGTTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTG[G/A]
AAGTTTATGTGAATAGGAAAGTTTGATGTGATGGAAAAAGTTGGAAGTTTGAAGAAAAAATTGGGATCTAAACATGGTGTTAGCTTGCTCTCGGTGCAAT

Reverse complement sequence

ATTGCACCGAGAGCAAGCTAACACCATGTTTAGATCCCAATTTTTTCTTCAAACTTCCAACTTTTTCCATCACATCAAACTTTCCTATTCACATAAACTT[C/T]
CAACTTTTCCGTCACATCGTTCCAATTTCAACCAAACTTCCAATTTTGACGTGAACTAAACACAGCTAGAACATTCACTCATTCACTGAAAACTCCTCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.80% 0.04% 0.00% NA
All Indica  2759 68.40% 31.60% 0.04% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 65.60% 34.40% 0.00% 0.00% NA
Indica III  913 54.70% 45.30% 0.00% 0.00% NA
Indica Intermediate  786 65.00% 34.90% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606974869 G -> A LOC_Os06g12760-LOC_Os06g12780 intergenic_region ; MODIFIER silent_mutation Average:79.541; most accessible tissue: Minghui63 panicle, score: 97.987 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0606974869 G A 0.0 -0.01 -0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606974869 NA 3.88E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 2.94E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 2.23E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 8.77E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 4.06E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 2.88E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 6.16E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 7.73E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 9.93E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 4.01E-07 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 5.00E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 9.89E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 4.05E-08 NA mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 1.16E-08 1.81E-12 mr1970 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 7.16E-07 NA mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 1.82E-07 4.67E-11 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 6.43E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 2.97E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974869 NA 5.99E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251