\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606974113:

Variant ID: vg0606974113 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 6974113
Reference Allele: AAlternative Allele: G,AAAAAG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTGCTTGAATTAGACTGAAGGCTAAAAAAGCAAAGGAGCTTGCCCAGTATGTTTGGCAATTTCCAGAGTTCCATTTGCTGCCTTACCTAAAGAAAGG[A/G,AAAAAG]
AAAAAGAGGAGGTGAGTCACAGCTTCACAAGACAATGCAAGTTATAACAAGAGCATCAAATCAAATGAGGTGTTTTTTTTCTTTCTCAGGGCATGGCCCC

Reverse complement sequence

GGGGCCATGCCCTGAGAAAGAAAAAAAACACCTCATTTGATTTGATGCTCTTGTTATAACTTGCATTGTCTTGTGAAGCTGTGACTCACCTCCTCTTTTT[T/C,CTTTTT]
CCTTTCTTTAGGTAAGGCAGCAAATGGAACTCTGGAAATTGCCAAACATACTGGGCAAGCTCCTTTGCTTTTTTAGCCTTCAGTCTAATTCAAGCAAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 37.90% 0.02% 0.02% AAAAAG: 6.92%
All Indica  2759 37.90% 50.30% 0.04% 0.04% AAAAAG: 11.71%
All Japonica  1512 97.80% 2.10% 0.00% 0.00% AAAAAG: 0.07%
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 38.20% 58.50% 0.17% 0.00% AAAAAG: 3.19%
Indica II  465 63.00% 36.30% 0.00% 0.22% AAAAAG: 0.43%
Indica III  913 22.80% 48.50% 0.00% 0.00% AAAAAG: 28.70%
Indica Intermediate  786 40.50% 54.50% 0.00% 0.00% AAAAAG: 5.09%
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 3.80% 0.00% 0.00% AAAAAG: 0.20%
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 66.70% 30.00% 0.00% 0.00% AAAAAG: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606974113 A -> DEL N N silent_mutation Average:71.869; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0606974113 A -> G LOC_Os06g12760-LOC_Os06g12780 intergenic_region ; MODIFIER silent_mutation Average:71.869; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0606974113 A -> AAAAAG LOC_Os06g12760-LOC_Os06g12780 intergenic_region ; MODIFIER silent_mutation Average:71.869; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0606974113 A AAAAA* 0.2 -0.09 -0.07 0.05 -0.04 -0.05
vg0606974113 A G 0.0 0.02 0.02 0.03 0.05 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606974113 NA 2.79E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 2.95E-06 NA mr1970 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 NA 1.71E-08 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 8.95E-06 NA mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 NA 5.19E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 NA 3.85E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 NA 1.09E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606974113 NA 1.14E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251