Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606970149:

Variant ID: vg0606970149 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6970149
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCGTCAAACTTTTCTTTAATGTGAAAGAAATGTAAAAATTAGTAAAAATATGTCAAAATATTCGAACATATATATGGTATGACATAATAGGGTCAAAC[A/G]
AGCAATATATAACTAAGCAAGGGCAAAATAGACTATTTATCCCTAACTTAACACCGTTAACTCACCTTAACATAACAGGGTCAGACGGATCGTTCATTTT

Reverse complement sequence

AAAATGAACGATCCGTCTGACCCTGTTATGTTAAGGTGAGTTAACGGTGTTAAGTTAGGGATAAATAGTCTATTTTGCCCTTGCTTAGTTATATATTGCT[T/C]
GTTTGACCCTATTATGTCATACCATATATATGTTCGAATATTTTGACATATTTTTACTAATTTTTACATTTCTTTCACATTAAAGAAAAGTTTGACGGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	13.10%	0.02%	0.00%	NA
All Indica	2759	78.20%	21.80%	0.00%	0.00%	NA
All Japonica	1512	99.30%	0.60%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	66.20%	33.80%	0.00%	0.00%	NA
Indica III	913	72.90%	27.10%	0.00%	0.00%	NA
Indica Intermediate	786	76.70%	23.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606970149	A -> G	LOC_Os06g12760-LOC_Os06g12780	intergenic_region ; MODIFIER	silent_mutation	Average:38.689; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606970149	NA	2.58E-09	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	8.61E-07	NA	mr1121	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	3.82E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	7.32E-06	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	5.04E-08	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	4.73E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	9.57E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	7.42E-07	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	8.94E-06	mr1749	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	8.77E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	1.74E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	3.34E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	1.28E-06	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	4.16E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	8.91E-06	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	4.48E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	1.41E-08	NA	mr1970	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	8.84E-07	1.88E-11	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	9.63E-08	NA	mr1973	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	4.57E-10	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	3.50E-07	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	6.18E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	7.55E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	2.76E-06	NA	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	2.10E-08	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	4.91E-07	NA	mr1973_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606970149	NA	1.14E-08	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251