| Variant ID: vg0606957055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6957055 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGATTTTAAGGCAGTATTGACTCCGTTGATGTCGTTCATCTTCTTGTCTCCAATCTCCGTTGACATCTTGGTGAAGGCGCCGATGCAGCAGCAGTAGCC[A/G]
TGAAGAACAAGAGCAGTCGTGCTACCCAAAAACTTGATCGCCCGCCTACCCGTGCAAGTTCTCAAGCGGACGAAGTTCCAGAGGCACCTGCTCGTCCCGT
ACGGGACGAGCAGGTGCCTCTGGAACTTCGTCCGCTTGAGAACTTGCACGGGTAGGCGGGCGATCAAGTTTTTGGGTAGCACGACTGCTCTTGTTCTTCA[T/C]
GGCTACTGCTGCTGCATCGGCGCCTTCACCAAGATGTCAACGGAGATTGGAGACAAGAAGATGAACGACATCAACGGAGTCAATACTGCCTTAAAATCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 22.80% | 2.41% | 0.00% | NA |
| All Indica | 2759 | 65.40% | 33.70% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 85.60% | 8.50% | 5.82% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 66.60% | 32.10% | 1.34% | 0.00% | NA |
| Indica II | 465 | 64.90% | 33.50% | 1.51% | 0.00% | NA |
| Indica III | 913 | 66.30% | 33.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 63.70% | 35.00% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 76.90% | 13.40% | 9.65% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 2.50% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606957055 | A -> G | LOC_Os06g12740.1 | upstream_gene_variant ; 967.0bp to feature; MODIFIER | silent_mutation | Average:45.187; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0606957055 | A -> G | LOC_Os06g12750.1 | downstream_gene_variant ; 1193.0bp to feature; MODIFIER | silent_mutation | Average:45.187; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0606957055 | A -> G | LOC_Os06g12740-LOC_Os06g12750 | intergenic_region ; MODIFIER | silent_mutation | Average:45.187; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606957055 | 9.82E-07 | NA | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606957055 | 4.57E-06 | NA | mr1152_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606957055 | 2.19E-06 | NA | mr1154_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606957055 | 9.93E-07 | 9.93E-07 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606957055 | 6.82E-06 | NA | mr1748_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |