\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606936078:

Variant ID: vg0606936078 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6936078
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCGCCACGTCAGTCAAAACCGCCTACCAAACCTCCGAGGGATCTCGTTTGTACCGGTTTTGACAGTTTAGGGACCGGTTATATCTGGTTTTGGGGTT[C/T]
AAGGACGAAAATCGGATTCGATGTAAAGTTAAGAGACCTCAGATGAACTTCCATTCTTTGAAGAAAGGCTTTAGAATAATGTACAAAAATGATGTTAAAT

Reverse complement sequence

ATTTAACATCATTTTTGTACATTATTCTAAAGCCTTTCTTCAAAGAATGGAAGTTCATCTGAGGTCTCTTAACTTTACATCGAATCCGATTTTCGTCCTT[G/A]
AACCCCAAAACCAGATATAACCGGTCCCTAAACTGTCAAAACCGGTACAAACGAGATCCCTCGGAGGTTTGGTAGGCGGTTTTGACTGACGTGGCGCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.40% 0.04% 0.00% NA
All Indica  2759 75.80% 24.10% 0.07% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 74.00% 26.00% 0.00% 0.00% NA
Indica III  913 58.30% 41.60% 0.11% 0.00% NA
Indica Intermediate  786 83.20% 16.70% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606936078 C -> T LOC_Os06g12690.1 upstream_gene_variant ; 3588.0bp to feature; MODIFIER silent_mutation Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0606936078 C -> T LOC_Os06g12710.1 upstream_gene_variant ; 2417.0bp to feature; MODIFIER silent_mutation Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0606936078 C -> T LOC_Os06g12690.3 upstream_gene_variant ; 3588.0bp to feature; MODIFIER silent_mutation Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0606936078 C -> T LOC_Os06g12690.5 upstream_gene_variant ; 3588.0bp to feature; MODIFIER silent_mutation Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0606936078 C -> T LOC_Os06g12700.1 downstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0606936078 C -> T LOC_Os06g12690-LOC_Os06g12700 intergenic_region ; MODIFIER silent_mutation Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606936078 5.44E-07 1.51E-09 mr1377 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078 1.48E-07 1.48E-07 mr1377 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078 NA 1.20E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078 NA 1.99E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078 NA 4.10E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251