\
| Variant ID: vg0606936078 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6936078 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 124. )
TAAGCGCCACGTCAGTCAAAACCGCCTACCAAACCTCCGAGGGATCTCGTTTGTACCGGTTTTGACAGTTTAGGGACCGGTTATATCTGGTTTTGGGGTT[C/T]
AAGGACGAAAATCGGATTCGATGTAAAGTTAAGAGACCTCAGATGAACTTCCATTCTTTGAAGAAAGGCTTTAGAATAATGTACAAAAATGATGTTAAAT
ATTTAACATCATTTTTGTACATTATTCTAAAGCCTTTCTTCAAAGAATGGAAGTTCATCTGAGGTCTCTTAACTTTACATCGAATCCGATTTTCGTCCTT[G/A]
AACCCCAAAACCAGATATAACCGGTCCCTAAACTGTCAAAACCGGTACAAACGAGATCCCTCGGAGGTTTGGTAGGCGGTTTTGACTGACGTGGCGCTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 75.80% | 24.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 58.30% | 41.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.20% | 16.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606936078 | C -> T | LOC_Os06g12690.1 | upstream_gene_variant ; 3588.0bp to feature; MODIFIER | silent_mutation | Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0606936078 | C -> T | LOC_Os06g12710.1 | upstream_gene_variant ; 2417.0bp to feature; MODIFIER | silent_mutation | Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0606936078 | C -> T | LOC_Os06g12690.3 | upstream_gene_variant ; 3588.0bp to feature; MODIFIER | silent_mutation | Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0606936078 | C -> T | LOC_Os06g12690.5 | upstream_gene_variant ; 3588.0bp to feature; MODIFIER | silent_mutation | Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0606936078 | C -> T | LOC_Os06g12700.1 | downstream_gene_variant ; 967.0bp to feature; MODIFIER | silent_mutation | Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0606936078 | C -> T | LOC_Os06g12690-LOC_Os06g12700 | intergenic_region ; MODIFIER | silent_mutation | Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606936078 | 5.44E-07 | 1.51E-09 | mr1377 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606936078 | 1.48E-07 | 1.48E-07 | mr1377 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606936078 | NA | 1.20E-06 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606936078 | NA | 1.99E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606936078 | NA | 4.10E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |