\
| Variant ID: vg0606853482 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6853482 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATGGATACCACGTACCTAGGGTTATGGATACCACATGCCTAACAGTAGTTGACTAAATCTCGGTAGGACCCACCACATACTATGTCTTATACGGAAACA[A/T]
CCTTCGGATATGGATGGAGTTTCGGATAAGGAAAGACAACTAGAGTTCTACATGGAAACGACAAGAACTACTCGGATTGTATCCATATTGGTTTCCCTAG
CTAGGGAAACCAATATGGATACAATCCGAGTAGTTCTTGTCGTTTCCATGTAGAACTCTAGTTGTCTTTCCTTATCCGAAACTCCATCCATATCCGAAGG[T/A]
TGTTTCCGTATAAGACATAGTATGTGGTGGGTCCTACCGAGATTTAGTCAACTACTGTTAGGCATGTGGTATCCATAACCCTAGGTACGTGGTATCCATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 15.70% | 0.06% | 0.34% | NA |
| All Indica | 2759 | 76.40% | 22.90% | 0.11% | 0.54% | NA |
| All Japonica | 1512 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.90% | 25.40% | 0.43% | 1.29% | NA |
| Indica III | 913 | 60.20% | 39.00% | 0.11% | 0.66% | NA |
| Indica Intermediate | 786 | 81.00% | 18.60% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606853482 | A -> T | LOC_Os06g12600.1 | downstream_gene_variant ; 4918.0bp to feature; MODIFIER | silent_mutation | Average:34.888; most accessible tissue: Callus, score: 69.946 | N | N | N | N |
| vg0606853482 | A -> T | LOC_Os06g12600-LOC_Os06g12610 | intergenic_region ; MODIFIER | silent_mutation | Average:34.888; most accessible tissue: Callus, score: 69.946 | N | N | N | N |
| vg0606853482 | A -> DEL | N | N | silent_mutation | Average:34.888; most accessible tissue: Callus, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606853482 | NA | 4.96E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606853482 | 6.65E-07 | 1.43E-10 | mr1377 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606853482 | 3.16E-07 | 3.16E-07 | mr1377 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606853482 | NA | 7.24E-06 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606853482 | NA | 7.11E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |